WormBase Tree Display for Variation: WBVar00250492
expand all nodes | collapse all nodes | view schema
WBVar00250492 | Name | Public_name | tm1500 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | M01F1.7.1:c.1313_1613del | |||||||
CE33673:p.Ile439GlnfsTer44 | ||||||||
HGVSg | CHROMOSOME_III:g.3523893_3524850del | |||||||
Sequence_details | SMap | S_parent | Sequence | C54C6 | ||||
Flanking_sequences | cgcacgtacgacgccgatggaggtgctgaa | attcattgtatgtctcatttgctcttcgta | ||||||
Mapping_target | C54C6 | |||||||
Source_location | 7 | CHROMOSOME_III | 3523892 | 3524851 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1500_external | |||||||
tm1500_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1500 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010813 | ||||||
Transcript | M01F1.7.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. McIntire to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: dyf+ in all sensory neurons. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | [C54C6] 799/800-[C54C6] 1757/1758 (958 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |