WormBase Tree Display for Variation: WBVar00250352

WBVar00250352 Name: Public_name: tm1357
    Other_name: Y59A8B.7.1:c.148-52_315+305delinsAATA
    HGVSg: CHROMOSOME_V:g.18045644_18046168delinsAATA
  Sequence_details: SMap: S_parent: Sequence: Y59A8B
    Flanking_sequences: attgcaaatttctaggtaaacctcaaaatt aggatctttacactgtgtatttactcataa
    Mapping_target: Y59A8B
    Source_location: 7 CHROMOSOME_V 18045643 18046169 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATA
      Deletion
    PCR_product: tm1357_external
      tm1357_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1357
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00305846
      WBGene00305847
      WBGene00013344
      WBGene00305845
    Transcript: Y59A8B.45
      Y59A8B.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y59A8B.7.1:c.148-52_315+305delinsAATA
        Intron_number: 2-3/6
        Exon_number: 3/7
      Y59A8B.44
      Y59A8B.46
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Ahringer to the National Bioresource Project of Japan: weak Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000646 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Ahringer to the National Bioresource Project of Japan: sluggish. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 116089/116090-AATA-116614/116615 (525 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele