WormBase Tree Display for Variation: WBVar00250282
expand all nodes | collapse all nodes | view schema
WBVar00250282 | Name | Public_name | tm1276 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F02E9.4a.1:c.676-101_889del | ||||||||
F02E9.4b.1:c.676-101_889del | |||||||||
HGVSg | CHROMOSOME_I:g.8417794_8418108del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02E9 | |||||
Flanking_sequences | ttcaaatattagatgatgatattttatcaa | aaagtactttctcatctgatgtacccgttt | |||||||
Mapping_target | F02E9 | ||||||||
Source_location | 7 | CHROMOSOME_I | 8417793 | 8418109 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1276_external | ||||||||
tm1276_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023475 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1276 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004117 | |||||||
Transcript | F02E9.4b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F02E9.4b.1:c.676-101_889del | ||||||||
cDNA_position | ?-890 | ||||||||
CDS_position | ?-889 | ||||||||
Protein_position | ?-297 | ||||||||
Intron_number | 2/21 | ||||||||
Exon_number | 3/22 | ||||||||
F02E9.4a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F02E9.4a.1:c.676-101_889del | ||||||||
cDNA_position | ?-905 | ||||||||
CDS_position | ?-889 | ||||||||
Protein_position | ?-297 | ||||||||
Intron_number | 2/21 | ||||||||
Exon_number | 3/22 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000141 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00055902 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson38493 | |||||||||
Remark | Comment from Dr. J. Satterlee to the National Bioresource Project of Japan: reduced brood size, more severe at 25 degree. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Fig 2 a &b | Paper_evidence | WBPaper00055902 | |||||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. K.L. Chow to the National Bioresource Project of Japan: small animal. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | KC | ||||||||
WBPhenotype:0000297 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. K.L. Chow to the National Bioresource Project of Japan: Ray patterning defects (fusion). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | KC | ||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Drs. J. Satterlee and Dr. K.L. Chow to the National Bioresource Project of Japan: protruding vulva. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | KC | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00055902 | |||||||
Curator_confirmed | WBPerson38493 | ||||||||
Remark | Fig. 1a lifespan of 10 and 14 days, respectively, as compared to 19 and 28 days in him-5 hermaphrodite worms | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0001212 | Paper_evidence | WBPaper00055902 | |||||||
Curator_confirmed | WBPerson38493 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005755 | PATO:0001362 | Paper_evidence | WBPaper00055902 | ||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0001575 | Paper_evidence | WBPaper00055902 | |||||||
Curator_confirmed | WBPerson38493 | ||||||||
EQ_annotations | Molecule_affected | WBMol:00001405 | PATO:0001997 | Paper_evidence | WBPaper00055902 | ||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0002263 | Paper_evidence | WBPaper00055902 | |||||||
Curator_confirmed | WBPerson38493 | ||||||||
EQ_annotations | GO_term | GO:0042391 | PATO:0000460 | Paper_evidence | WBPaper00055902 | ||||
Curator_confirmed | WBPerson38493 | ||||||||
GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_not_observed | WBPhenotype:0000020 | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
EQ_annotations | GO_term | GO:0043050 | PATO:0000460 | Paper_evidence | WBPaper00055902 | ||||
Curator_confirmed | WBPerson38493 | ||||||||
Phenotype_assay | Strain | WBStrain00023475 | Paper_evidence | WBPaper00055902 | |||||
Curator_confirmed | WBPerson38493 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00055902 | ||||||
Curator_confirmed | WBPerson38493 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the NBP from Dr. M. Han: suppress synMuv; Dr. M. Peter: does not suppress par-2 (RNAi). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
TA | |||||||||
MH | |||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to NBP from Dr. J. Ahringer: non-Pvl. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JA | ||||||||
Reference | WBPaper00055902 | ||||||||
Remark | 13398/13399-13713/13714 (315 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |