WormBase Tree Display for Variation: WBVar00249871

WBVar00249871 Name: Public_name: tm845
    Other_name (25)
    HGVSg: CHROMOSOME_V:g.6128486_6128868del
  Sequence_details: SMap: S_parent: Sequence: F12F3
    Flanking_sequences: cgtcactgagttgttttccaaatgatggag ttcttctttttcttttcatcagccttgaca
    Mapping_target: F12F3
    Source_location: 7 CHROMOSOME_V 6128485 6128869 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm845_external
      tm845_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 845
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006436
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [F12F3] 7090/7091-[F12F3] 7473/7474 (383 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele