WormBase Tree Display for Variation: WBVar00249698
expand all nodes | collapse all nodes | view schema
WBVar00249698 | Name | Public_name | tm666 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.19050641_19051121delinsTTTA | |||||||
Sequence_details | SMap | S_parent | Sequence | Y39B6A | ||||
Flanking_sequences | cggcgtgctgtgaagccaagaaggcggtgt | tgaagcttaacacgatttgaggcagtttcc | ||||||
Mapping_target | Y39B6A | |||||||
Source_location | 7 | CHROMOSOME_V | 19050640 | 19051122 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TTTA | ||||||
Deletion | ||||||||
PCR_product | tm666_external | |||||||
tm666_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 666 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000214 | ||||||
Transcript | Y39B6A.20.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-112 | |||||||
CDS_position | ?-112 | |||||||
Protein_position | ?-38 | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000324 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: slightly shorter. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IR | |||||||
WBPhenotype:0000547 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: starved appearance. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IR | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: less progeny at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IR | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001507 | Paper_evidence | WBPaper00049138 | ||||||
Person_evidence | WBPerson18666 | |||||||
Curator_confirmed | WBPerson18666 | |||||||
Remark | mutants are tolerant to Cry6Aa protein | Paper_evidence | WBPaper00049138 | |||||
Person_evidence | WBPerson18666 | |||||||
Curator_confirmed | WBPerson18666 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IR | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IR | |||||||
Reference | WBPaper00049138 | |||||||
Remark | 92584/92585-TTTA-93065/93066 (481 bp deletion + 4 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |