WormBase Tree Display for Variation: WBVar00249665

WBVar00249665 Name: Public_name: tm631
    Other_name: CE42317:p.Gly26Ter
      C04E12.7.1:c.75_381del
    HGVSg: CHROMOSOME_V:g.3356589_3357119del
  Sequence_details: SMap: S_parent: Sequence: C04E12
    Flanking_sequences: ttcaattgtgctcttgtttgttgaacctaa ggttgagttgtgatggcttgactttgagat
    Mapping_target: C04E12
    Source_location: 7 CHROMOSOME_V 3356588 3357120 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm631_external
      tm631_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 631
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015437
    Transcript: C04E12.7.1 (11)
    Interactor: WBInteraction000050587
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
  Remark: 3069/3070-3600/3601 (531 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele