WormBase Tree Display for Variation: WBVar00249559

WBVar00249559 Name: Public_name: tm519
    HGVSg: CHROMOSOME_II:g.5557136_5557547delinsCG
  Sequence_details: SMap: S_parent: Sequence: C17C3
    Flanking_sequences: atgatctcatttcttgttaatataatattc tggatcagactaatctcgctttctagttaa
    Mapping_target: C17C3
    Source_location: 7 CHROMOSOME_II 5557135 5557548 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CG
      Deletion
    PCR_product: tm519_external
      tm519_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 519
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002094
    Transcript: C17C3.4.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 354-?
        Exon_number: 4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000308 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Ruvkun to the National Bioresource Project of Japan: no effect on dauer arrest. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000603 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Driscoll to the National Bioresource Project of Japan: no are-related muscle defects found. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000639 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: does not form dauers at 25C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. P.W. Sternberg: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001507 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 27026/27027-CG-27438/27439 (412 bp deletion + 2bp insertion )
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele