WormBase Tree Display for Variation: WBVar00249559
expand all nodes | collapse all nodes | view schema
WBVar00249559 | Name (2) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C17C3 | ||||
Flanking_sequences | atgatctcatttcttgttaatataatattc | tggatcagactaatctcgctttctagttaa | ||||||
Mapping_target | C17C3 | |||||||
Source_location | 7 | CHROMOSOME_II | 5557135 | 5557548 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CG | ||||||
Deletion | ||||||||
PCR_product | tm519_external | |||||||
tm519_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 519 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002094 | ||||||
Transcript | C17C3.4.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 354-? | |||||||
Exon_number | 4/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000308 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Ruvkun to the National Bioresource Project of Japan: no effect on dauer arrest. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000603 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Driscoll to the National Bioresource Project of Japan: no are-related muscle defects found. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000639 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: does not form dauers at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P.W. Sternberg: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001507 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 27026/27027-CG-27438/27439 (412 bp deletion + 2bp insertion ) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |