WormBase Tree Display for Variation: WBVar00249516
expand all nodes | collapse all nodes | view schema
WBVar00249516 | Name | Public_name | tm472 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | B0285.5.3:c.666_1249del | ||||||||
CE36681:p.Asn223GlyfsTer38 | |||||||||
B0285.5.2:c.666_1249del | |||||||||
B0285.5.1:c.666_1249del | |||||||||
HGVSg | CHROMOSOME_III:g.4346657_4347904del | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0285 | |||||
Flanking_sequences | aatgcatgaaacaactgaacgattgttttt | tggaaagatcaattgccgagagaaagttgg | |||||||
Mapping_target | B0285 | ||||||||
Source_location | 7 | CHROMOSOME_III | 4346656 | 4347905 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm472_external | ||||||||
tm472_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029322 | ||||||||
WBStrain00040542 | |||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 472 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002003 | |||||||
Transcript | B0285.5.1 (11) | ||||||||
B0285.5.3 (11) | |||||||||
B0285.5.2 (11) | |||||||||
Interactor | WBInteraction000524033 | ||||||||
WBInteraction000524034 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00029002 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000541 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Roughly half of the commissures that make an incorrect midline choice reach the dorsal nerve cord | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000632 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Severe defasciculation defects | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Midline crossover defects of PVQL and PVQR as well as AVK axons, with either contralateral analog inappropriately crossing the midline | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006823 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oyIs14, bwIs2 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The midline choice (where the axons turn at the midline either to the left or right) is affected. | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002491 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Ectopic neurite outgrowth defects in the DVB tail motor neurons | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Not daf-c | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00040941 | |||||||
Curator_confirmed | WBPerson1705 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00006471 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed (2) | |||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
Non-lethal | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000245 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in SM migration | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in HSN migration | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The nervous system is grossly intact in all mutants | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term (13) | ||||||||
Phenotype_assay | Treatment | DiI staining | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | oyIs17, otEx404, mgIs18, uIs25, otEx1043, zdIs5, otEx1082, otIs39, evIs82b, wdIs3 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-Unc | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-sterile | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00032413 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Removal of C5-epimerization does not result in significant defects in the sidedness of DA/DB motor axon projections | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040941 | ||||||||
WBPaper00032413 | |||||||||
WBPaper00029002 | |||||||||
WBPaper00006471 | |||||||||
Remark | 15975/15976-17223/17224 (1248 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |