WormBase Tree Display for Variation: WBVar00249442
expand all nodes | collapse all nodes | view schema
WBVar00249442 | Name | Public_name | tm394 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C56A3.7b.1:c.162_370-130delinsA | ||||||||
C56A3.7a.1:c.258_466-130delinsA | |||||||||
C56A3.7d.1:c.73-72_256-130delinsA | |||||||||
HGVSg | CHROMOSOME_V:g.13557503_13558341delinsA | ||||||||
Sequence_details | SMap | S_parent | Sequence | C56A3 | |||||
Flanking_sequences | tcaagaagtaccaactcctcagagacgtag | aaaacaaagaaaaacacttagtgttatcaa | |||||||
Mapping_target | C56A3 | ||||||||
Source_location | 7 | CHROMOSOME_V | 13557502 | 13558342 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | A | |||||||
Deletion | |||||||||
PCR_product | tm394_external | ||||||||
tm394_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 394 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000302 | |||||||
Transcript | C56A3.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C56A3.7a.1:c.258_466-130delinsA | ||||||||
cDNA_position | 314-? | ||||||||
CDS_position | 258-? | ||||||||
Protein_position | 86-? | ||||||||
Intron_number | 4-6/11 | ||||||||
Exon_number | 4-6/12 | ||||||||
C56A3.7d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C56A3.7d.1:c.73-72_256-130delinsA | ||||||||
Intron_number | 1-3/7 | ||||||||
Exon_number | 2-3/8 | ||||||||
C56A3.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C56A3.7b.1:c.162_370-130delinsA | ||||||||
cDNA_position | 162-? | ||||||||
CDS_position | 162-? | ||||||||
Protein_position | 54-? | ||||||||
Intron_number | 2-4/8 | ||||||||
Exon_number | 2-4/9 | ||||||||
Interactor | WBInteraction000525135 | ||||||||
WBInteraction000525136 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Mapping_data | In_multi_point | 4176 | |||||||
Description | Phenotype | WBPhenotype:0000026 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. Dr. H. Baylis: defective lipid uptake in inetstine, alteration in endocytosis, slightly reduced brood size, | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | AA | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00046406 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Comment from Dr. H. Baylis to the National Bioresource Project of Japan: slightly reduced brood size. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comment from Dr. Dr. H. Baylis: defective lipid uptake in inetstine, alteration in endocytosis, slightly reduced brood size, | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | AA | ||||||||
cav-2(tm394) mutants have a slight but reproducible reduction in brood size (N2: 315 +/- 8; cav-2(tm394): 284 +/- 28; mean +/- SD). | Paper_evidence | WBPaper00046406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000338 | Paper_evidence | WBPaper00046406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 6A,B | Paper_evidence | WBPaper00046406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Baylis to National Bioresource Project of Japan: slightly reduced brood size. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00046406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | cav-2(tm394) mutant worms exhibit increased and punctate accumulations of YP-170::GFP (VIT-2::GFP) in the pseudocoelom and tail (Figure 6A,6E). Levels of YP-170::GFP in the intestine appeared normal but less localized to the basolateral membrane compared with wild type. | Paper_evidence | WBPaper00046406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | YP-170::GFP (VIT-2::GFP) | Paper_evidence | WBPaper00046406 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000725 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Baylis to National Bioresource Project of Japan: defective lipid uptake in inestine. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comment from Dr. H. Baylis to the National Bioresource Project of Japan: defective lipid uptake in intestine. | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001421 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Baylis to National Bioresource Project of Japan: alteration in endocytosis. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comment from Dr. H. Baylis to the National Bioresource Project of Japan: alteration in endocytosis. | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Comment from Dr. Dr. H. Baylis: defective lipid uptake in inetstine, alteration in endocytosis, slightly reduced brood size, | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | AA | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001763 | Paper_evidence | WBPaper00046406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | cav-2(tm394) mutant animals exhibited reduced apical uptake of the lipid-phase marker dye FM4-64 and BODIPY-tagged lactosylceramide (BODIPY FL C5 LacCer, Invitrogen) into intestinal cells, compared to wild type controls (Figures 2,3) | Paper_evidence | WBPaper00046406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00020904 | ||||||||
WBTransgene00020905 | |||||||||
Phenotype_not_observed (14) | |||||||||
Reference | WBPaper00028448 | ||||||||
WBPaper00046406 | |||||||||
Remark | 31168/31169-A-32007/32008 (839 bp deletion + 1 bp addition) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |