WormBase Tree Display for Variation: WBVar00249387

WBVar00249387 Name: Public_name: tm339
    HGVSg: CHROMOSOME_I:g.8148480_8149895delinsAATCGGG
  Sequence_details: SMap: S_parent: Sequence: T28B8
    Flanking_sequences: gaaacagggaaataacattttttcgggaga aaaatcggcacattctctcccacaaattaa
    Mapping_target: T28B8
    Source_location: 7 CHROMOSOME_I 8148479 8149896 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATCGGG
      Deletion
    PCR_product: tm339_external
      tm339_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 339
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002101
    Transcript: T28B8.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/4
        Exon_number: 3-5/5
    Interactor: WBInteraction000543178
      WBInteraction000543200
      WBInteraction000543230
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000637 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. J. Alcedo: non-Daf-c at 25C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000012 Paper_evidence: WBPaper00042184
        Curator_confirmed: WBPerson2987
        Remark: "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." Paper_evidence: WBPaper00042184
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000013 Paper_evidence: WBPaper00042184
        Curator_confirmed: WBPerson2987
        Remark: "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " Paper_evidence: WBPaper00042184
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000039 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. C. Kenyon: normal life span. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CF
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000540 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. P. Roy: normal muscle arm development Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RP
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. P.W. Sternberg: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: PS
  Reference: WBPaper00042184
  Remark: 17514/17515-AATCGGG-18930/18931 (1416 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele