WormBase Tree Display for Variation: WBVar00249259
expand all nodes | collapse all nodes | view schema
| WBVar00249259 | Evidence | Paper_evidence | WBPaper00051462 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | tg26 | |||||||
| Other_name | CE12272:p.Arg243Gln | ||||||||
| CE30556:p.Arg191Gln | |||||||||
| M01D7.7a.1:c.728G>A | |||||||||
| M01D7.7b.1:c.572G>A | |||||||||
| HGVSg | CHROMOSOME_I:g.1840099G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | M01D7 | |||||
| Flanking_sequences | aaacaaactagaaatcaatcttgcagaacc | aatggaagaatcgaaagctctgttccgaac | |||||||
| Mapping_target | M01D7 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00051462 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004924 | ||||||||
| Laboratory | KY | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001196 | |||||||
| Transcript | M01D7.7b.1 (12) | ||||||||
| M01D7.7a.1 (12) | |||||||||
| Interactor | WBInteraction000052330 | ||||||||
| WBInteraction000052331 | |||||||||
| WBInteraction000518039 | |||||||||
| WBInteraction000518669 | |||||||||
| WBInteraction000521450 | |||||||||
| Genetics | Interpolated_map_position | I | -12.5484 | ||||||
| Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00005092 | |||||
| Curator_confirmed | WBPerson7249 | ||||||||
| EQ_annotations | Molecule_affected | WBMol:00003650 | PATO:0000460 | Paper_evidence | WBPaper00005092 | ||||
| Curator_confirmed | WBPerson7249 | ||||||||
| WBPhenotype:0000795 | Paper_evidence | WBPaper00050847 | |||||||
| Curator_confirmed | WBPerson38423 | ||||||||
| Remark | "Gain-of-function mutation of egl-30 led to a decrease of flipping rate in and outside of lethargus (figure 6B)" | Paper_evidence | WBPaper00050847 | ||||||
| Curator_confirmed | WBPerson38423 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00050847 | ||||||
| Curator_confirmed | WBPerson38423 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | |||||
| Curator_confirmed | WBPerson38423 | ||||||||
| WBPhenotype:0001502 | Paper_evidence | WBPaper00030770 | |||||||
| Curator_confirmed | WBPerson919 | ||||||||
| Remark | Figure 4, mutant animals do not show reduced locomotion activity on melatonin | Paper_evidence | WBPaper00030770 | ||||||
| Curator_confirmed | WBPerson919 | ||||||||
| Affected_by | Molecule | WBMol:00003594 | Paper_evidence | WBPaper00030770 | |||||
| Curator_confirmed | WBPerson919 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutations in egl-30 did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040857 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002114 | Paper_evidence | WBPaper00038270 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not become paralyzed after 10 minutes of swimming. | Paper_evidence | WBPaper00038270 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00038270 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00038270 | ||||||||
| WBPaper00040857 | |||||||||
| WBPaper00005092 | |||||||||
| WBPaper00019209 | |||||||||
| WBPaper00018536 | |||||||||
| WBPaper00030770 | |||||||||
| WBPaper00050847 | |||||||||
| WBPaper00051462 | |||||||||
| Method | Substitution_allele |
