WormBase Tree Display for Variation: WBVar00249259
expand all nodes | collapse all nodes | view schema
WBVar00249259 | Evidence | Paper_evidence | WBPaper00051462 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | tg26 | |||||||
Other_name (4) | |||||||||
HGVSg | CHROMOSOME_I:g.1840099G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | M01D7 | |||||
Flanking_sequences | aaacaaactagaaatcaatcttgcagaacc | aatggaagaatcgaaagctctgttccgaac | |||||||
Mapping_target | M01D7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00051462 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004924 | ||||||||
Laboratory | KY | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001196 | |||||||
Transcript | M01D7.7b.1 (12) | ||||||||
M01D7.7a.1 (12) | |||||||||
Interactor | WBInteraction000052330 | ||||||||
WBInteraction000052331 | |||||||||
WBInteraction000518039 | |||||||||
WBInteraction000518669 | |||||||||
WBInteraction000521450 | |||||||||
Genetics | Interpolated_map_position | I | -12.5484 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00005092 | |||||
Curator_confirmed | WBPerson7249 | ||||||||
EQ_annotations | Molecule_affected | WBMol:00003650 | PATO:0000460 | Paper_evidence | WBPaper00005092 | ||||
Curator_confirmed | WBPerson7249 | ||||||||
WBPhenotype:0000795 | Paper_evidence | WBPaper00050847 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "Gain-of-function mutation of egl-30 led to a decrease of flipping rate in and outside of lethargus (figure 6B)" | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001502 | Paper_evidence | WBPaper00030770 | |||||||
Curator_confirmed | WBPerson919 | ||||||||
Remark | Figure 4, mutant animals do not show reduced locomotion activity on melatonin | Paper_evidence | WBPaper00030770 | ||||||
Curator_confirmed | WBPerson919 | ||||||||
Affected_by | Molecule | WBMol:00003594 | Paper_evidence | WBPaper00030770 | |||||
Curator_confirmed | WBPerson919 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutations in egl-30 did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002114 | Paper_evidence | WBPaper00038270 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not become paralyzed after 10 minutes of swimming. | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038270 | ||||||||
WBPaper00040857 | |||||||||
WBPaper00005092 | |||||||||
WBPaper00019209 | |||||||||
WBPaper00018536 | |||||||||
WBPaper00030770 | |||||||||
WBPaper00050847 | |||||||||
WBPaper00051462 | |||||||||
Method | Substitution_allele |