WormBase Tree Display for Variation: WBVar00249256
expand all nodes | collapse all nodes | view schema
WBVar00249256 | Evidence | Paper_evidence | WBPaper00005198 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | te41 | |||||
Other_name | C09G9.6.1:c.-69G>A | ||||||
HGVSg | CHROMOSOME_IV:g.8889017G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C09G9 | |||
Flanking_sequences | cgcaacatcttccggaaatcgagtatctcc | gtgttgattgttaagcattccctgcacccg | |||||
Mapping_target | C09G9 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005198 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003864 | |||||
Transcript | C09G9.6.1 | VEP_consequence | 5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | C09G9.6.1:c.-69G>A | ||||||
cDNA_position | 42 | ||||||
Exon_number | 1/8 | ||||||
Genetics | Interpolated_map_position | IV | 3.99874 | ||||
Reference | WBPaper00005198 | ||||||
Remark | both te26 and te41 have the g to a change in the predicted 5' UTR that creats an ATG upstream of the predicted translation start site [021017 ck1] | ||||||
Method | Substitution_allele |