WormBase Tree Display for Variation: WBVar00249255
expand all nodes | collapse all nodes | view schema
| WBVar00249255 | Evidence | Paper_evidence | WBPaper00005198 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | te36 | |||||
| Other_name | CE03005:p.Gly138Glu | ||||||
| C09G9.6.1:c.413G>A | |||||||
| HGVSg | CHROMOSOME_IV:g.8889592G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | C27B7 | |||
| Flanking_sequences | ctttcgcagacaactgccggtttgcacatg | agaggaggaacttcgtccaacattgtaaga | |||||
| Mapping_target | C27B7 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005198 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TX | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003864 | |||||
| Transcript | C09G9.6.1 (12) | ||||||
| Genetics | Interpolated_map_position | IV | 3.99899 | ||||
| Reference | WBPaper00005198 | ||||||
| Remark | the change results in a change from Gly to Glu in the predicted coding sequence [021016 ck1] | ||||||
| Method | Substitution_allele |
