WormBase Tree Display for Variation: WBVar00249254

WBVar00249254 Evidence: Paper_evidence: WBPaper00005198
  Name: Public_name: te35
    Other_name: CE03005:p.Trp294Ter
      C09G9.6.1:c.881G>A
    HGVSg: CHROMOSOME_IV:g.8890189G>A
  Sequence_details: SMap: S_parent: Sequence: C27B7
    Flanking_sequences: tggatccatcgatgtttgctctagacgctt gaatatggcacatcggccagctagtccact
    Mapping_target: C27B7
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00005198
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: TX
    Status: Live
  Affects: Gene: WBGene00003864
    Transcript: C09G9.6.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09G9.6.1:c.881G>A
        HGVSp: CE03005:p.Trp294Ter
        cDNA_position: 991
        CDS_position: 881
        Protein_position: 294
        Exon_number: 7/8
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
  Genetics: Interpolated_map_position: IV 3.99921
  Reference: WBPaper00005198
  Remark: G to A change causes Trp to stop [021016 ck1]
  Method: Substitution_allele