WormBase Tree Display for Variation: WBVar00249251
expand all nodes | collapse all nodes | view schema
| WBVar00249251 | Evidence | Paper_evidence | WBPaper00005198 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | te28 | |||||
| Other_name | C09G9.6.1:c.438-1G>A | ||||||
| HGVSg | CHROMOSOME_IV:g.8889658G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | C27B7 | |||
| Flanking_sequences | gcaaacaaattatgttaattccaattttta | cgtcgagccgctgcagaacaataagtataa | |||||
| Mapping_target | C27B7 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005198 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TX | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003864 | |||||
| Transcript | C09G9.6.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C09G9.6.1:c.438-1G>A | ||||||
| Intron_number | 4/7 | ||||||
| Genetics | Interpolated_map_position | IV | 3.99902 | ||||
| Reference | WBPaper00005198 | ||||||
| Remark | g to a change in the 3' splice site of intron 3 [021016 ck1] | ||||||
| Method | Substitution_allele |
