WormBase Tree Display for Variation: WBVar00249248
expand all nodes | collapse all nodes | view schema
WBVar00249248 | Evidence | Paper_evidence | WBPaper00005198 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | te22 | |||||
Other_name (2) | |||||||
HGVSg | CHROMOSOME_IV:g.8889737G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C27B7 | |||
Flanking_sequences | atatacgactacaggactctgcccatacgg | aaacggtgccttttcattcatcccgatcat | |||||
Mapping_target | C27B7 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005198 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003864 | |||||
Transcript | C09G9.6.1 | VEP_consequence | synonymous_variant | ||||
VEP_impact | LOW | ||||||
HGVSc | C09G9.6.1:c.516G>A | ||||||
HGVSp | CE03005:p.Gly172= | ||||||
cDNA_position | 626 | ||||||
CDS_position | 516 | ||||||
Protein_position | 172 | ||||||
Exon_number | 5/8 | ||||||
Codon_change | ggG/ggA | ||||||
Amino_acid_change | G | ||||||
Genetics | Interpolated_map_position | IV | 3.99905 | ||||
Reference | WBPaper00005198 | ||||||
Remark | G to A change causes Gly to Ala change in the coding region. [021016 ck1] | ||||||
Method | Substitution_allele |