WormBase Tree Display for Variation: WBVar00249131
expand all nodes | collapse all nodes | view schema
| WBVar00249131 | Evidence | Paper_evidence | WBPaper00003656 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | t1534 | |||||||
| Other_name (12) | |||||||||
| HGVSg | CHROMOSOME_III:g.13722409G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | W06F12 | |||||
| Flanking_sequences | gaccaacgtgaccggctcaacatgacacac | aggttgtgacccagtactatagagccccgg | |||||||
| Mapping_target | W06F12 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003656 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00007769 | ||||||||
| Laboratory | GE | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003048 | |||||||
| Transcript | W06F12.1a.1 (12) | ||||||||
| W06F12.1c.1 (12) | |||||||||
| W06F12.1b.1 (12) | |||||||||
| W06F12.1e.1 (12) | |||||||||
| W06F12.1d.2 (12) | |||||||||
| W06F12.1d.1 (12) | |||||||||
| W06F12.1d.3 (12) | |||||||||
| Interactor | WBInteraction000500217 | ||||||||
| WBInteraction000520244 | |||||||||
| WBInteraction000520246 | |||||||||
| WBInteraction000557667 | |||||||||
| WBInteraction000557674 | |||||||||
| WBInteraction000557681 | |||||||||
| WBInteraction000557688 | |||||||||
| WBInteraction000557695 | |||||||||
| WBInteraction000557702 | |||||||||
| Genetics | Interpolated_map_position | III | 21.4035 | ||||||
| Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00002946 | |||||
| WBPaper00003363 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| Remark | From a collection of maternal-effect embryonic lethal mutations isolated on LG III (R. Schnabel, H. Schnabel, R. Feichtinger and T. Kaletta, unpublished results). | Paper_evidence | WBPaper00003363 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00002946 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00003363 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C, 25C | Paper_evidence | WBPaper00002946 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | unc-32(e189) | Paper_evidence | WBPaper00002946 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000472 | Paper_evidence | WBPaper00003570 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Less than 5% of embryos have no endoderm. This phenotype is rescued by [GFP::LIT-1]. | Paper_evidence | WBPaper00003570 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Low | Paper_evidence | WBPaper00003570 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 22 deg C | Paper_evidence | WBPaper00003570 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001276 | Paper_evidence | WBPaper00003363 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants yielded ectopic expression in some AB-derived blastomeres, but never all of them, showing expression not seen in a wild-type genetic background. Beta-Galactosidase staining is still observed in cells where expression is detected in the control strain. | Paper_evidence | WBPaper00003363 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001597 | Paper_evidence | WBPaper00002946 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | 36 body-wall muscle cells are missing. Both MS and C-blastomere lineages are affected | Paper_evidence | WBPaper00002946 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| Phenotype_assay | Treatment | Staining with NE8 4C6.3 antibody | Paper_evidence | WBPaper00002946 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001635 | Paper_evidence | WBPaper00002946 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| Phenotype_assay | Treatment | Staining with 3NB12 antibody | Paper_evidence | WBPaper00002946 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001968 | Paper_evidence | WBPaper00005116 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 4 | Paper_evidence | WBPaper00005116 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002213 | Paper_evidence | WBPaper00003656 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | The "THK" mutant LIT-1 protein encoded by the lit-1(t1534) allele exhibited reduced phosphorylation of the proteins POP-1, LIT-1, and WRM-1. | Paper_evidence | WBPaper00003656 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00003363 | ||||||||
| WBPaper00003570 | |||||||||
| WBPaper00005116 | |||||||||
| WBPaper00003656 | |||||||||
| WBPaper00002946 | |||||||||
| Method | Substitution_allele |
