WormBase Tree Display for Variation: WBVar00249131
expand all nodes | collapse all nodes | view schema
WBVar00249131 | Evidence | Paper_evidence | WBPaper00003656 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | t1534 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_III:g.13722409G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W06F12 | |||||
Flanking_sequences | gaccaacgtgaccggctcaacatgacacac | aggttgtgacccagtactatagagccccgg | |||||||
Mapping_target | W06F12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003656 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007769 | ||||||||
Laboratory | GE | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | III | 21.4035 | ||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00002946 | |||||
WBPaper00003363 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | From a collection of maternal-effect embryonic lethal mutations isolated on LG III (R. Schnabel, H. Schnabel, R. Feichtinger and T. Kaletta, unpublished results). | Paper_evidence | WBPaper00003363 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00003363 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C, 25C | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | unc-32(e189) | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000472 | Paper_evidence | WBPaper00003570 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Less than 5% of embryos have no endoderm. This phenotype is rescued by [GFP::LIT-1]. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 22 deg C | Paper_evidence | WBPaper00003570 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00003363 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants yielded ectopic expression in some AB-derived blastomeres, but never all of them, showing expression not seen in a wild-type genetic background. Beta-Galactosidase staining is still observed in cells where expression is detected in the control strain. | Paper_evidence | WBPaper00003363 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001597 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 36 body-wall muscle cells are missing. Both MS and C-blastomere lineages are affected | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | Staining with NE8 4C6.3 antibody | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001635 | Paper_evidence | WBPaper00002946 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002946 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002946 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | Staining with 3NB12 antibody | Paper_evidence | WBPaper00002946 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001968 | Paper_evidence | WBPaper00005116 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 4 | Paper_evidence | WBPaper00005116 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002213 | Paper_evidence | WBPaper00003656 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The "THK" mutant LIT-1 protein encoded by the lit-1(t1534) allele exhibited reduced phosphorylation of the proteins POP-1, LIT-1, and WRM-1. | Paper_evidence | WBPaper00003656 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00003363 | ||||||||
WBPaper00003570 | |||||||||
WBPaper00005116 | |||||||||
WBPaper00003656 | |||||||||
WBPaper00002946 | |||||||||
Method | Substitution_allele |