WormBase Tree Display for Variation: WBVar00249043
expand all nodes | collapse all nodes | view schema
| WBVar00249043 | Evidence | Paper_evidence | WBPaper00035599 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sy705 | |||||||
| Other_name | sy704 | Paper_evidence | WBPaper00035599 | ||||||
| sy710 | Paper_evidence | WBPaper00035599 | |||||||
| F25H8.6.1:c.511C>T | |||||||||
| CE05731:p.Gln171Ter | |||||||||
| HGVSg | CHROMOSOME_IV:g.9917903C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F25H8 | |||||
| Flanking_sequences | ATGATTCGCCACTTGAGAAGTTGTCATGTT | aagagtatcagcttgtccaagaagctcgacagaa | |||||||
| Mapping_target | F25H8 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035599 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00030952 | ||||||||
| WBStrain00056458 | |||||||||
| Laboratory | PS | ||||||||
| CHB | |||||||||
| History | Acquires_merge | WBVar00249042 | |||||||
| WBVar00249044 | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00009133 | |||||||
| Transcript | F25H8.6.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F25H8.6.1:c.511C>T | ||||||||
| HGVSp | CE05731:p.Gln171Ter | ||||||||
| cDNA_position | 534 | ||||||||
| CDS_position | 511 | ||||||||
| Protein_position | 171 | ||||||||
| Exon_number | 4/10 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000504243 | ||||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00035599 | |||||
| Genetics | Interpolated_map_position | IV | 4.4464 | ||||||
| Description | Phenotype (5) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000289 | Paper_evidence | WBPaper00035599 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The gross morphology of the uterus was normal in the strongest bed-3 mutant, bed-3(sy705). No difference in the number of cog-2::gfp expressing cells in the wild type and bed-3 mutants | Paper_evidence | WBPaper00035599 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000515 | Paper_evidence | WBPaper00035599 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | bed-3 mutations do not affect Pn.a lineages. | Paper_evidence | WBPaper00035599 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000701 | Paper_evidence | WBPaper00035599 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Same number of seam cell nuclei in bed-3(sy705) mutants as in the wild type | Paper_evidence | WBPaper00035599 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00035599 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00035599 | ||||||||
| WBPaper00065979 | |||||||||
| Method | Substitution_allele |
