WormBase Tree Display for Variation: WBVar00249043
expand all nodes | collapse all nodes | view schema
WBVar00249043 | Evidence | Paper_evidence | WBPaper00035599 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy705 | |||||||
Other_name | sy704 | Paper_evidence | WBPaper00035599 | ||||||
sy710 | Paper_evidence | WBPaper00035599 | |||||||
F25H8.6.1:c.511C>T | |||||||||
CE05731:p.Gln171Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.9917903C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F25H8 | |||||
Flanking_sequences | ATGATTCGCCACTTGAGAAGTTGTCATGTT | aagagtatcagcttgtccaagaagctcgacagaa | |||||||
Mapping_target | F25H8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035599 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030952 | ||||||||
WBStrain00056458 | |||||||||
Laboratory | PS | ||||||||
CHB | |||||||||
History | Acquires_merge (2) | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00009133 | |||||||
Transcript | F25H8.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25H8.6.1:c.511C>T | ||||||||
HGVSp | CE05731:p.Gln171Ter | ||||||||
cDNA_position | 534 | ||||||||
CDS_position | 511 | ||||||||
Protein_position | 171 | ||||||||
Exon_number | 4/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000504243 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00035599 | |||||
Genetics | Interpolated_map_position | IV | 4.4464 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bed-3 mutations caused an Egl (egg-laying defective) phenotype | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000111 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bed-3(sy705) affected the vulval expression pattern of cdh-3::cfp | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Granddaughters of P5.p, P6.p and P7.p often failed to divide in bed-3 mutants. bed-3(sy705) caused a specific loss of the third (terminal) division | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bed-3 mutation also caused molting defects | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pvl | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000289 | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The gross morphology of the uterus was normal in the strongest bed-3 mutant, bed-3(sy705). No difference in the number of cog-2::gfp expressing cells in the wild type and bed-3 mutants | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000515 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bed-3 mutations do not affect Pn.a lineages. | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000701 | Paper_evidence | WBPaper00035599 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Same number of seam cell nuclei in bed-3(sy705) mutants as in the wild type | Paper_evidence | WBPaper00035599 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00035599 | ||||||||
WBPaper00065979 | |||||||||
Method | Substitution_allele |