WormBase Tree Display for Variation: WBVar00249030
expand all nodes | collapse all nodes | view schema
WBVar00249030 | Evidence | Paper_evidence | WBPaper00005799 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy673 | |||||||
Other_name (38) | |||||||||
HGVSg | CHROMOSOME_III:g.4139814G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C30D11 | |||||
Flanking_sequences | tttcagtccgttcaaagcagtatgggattg | ataattctgttacttgtaatatatacggct | |||||||
Mapping_target | C30D11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005799 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006830 | |||||||
Transcript (19) | |||||||||
Genetics | Interpolated_map_position | III | -3.78446 | ||||||
Description | Phenotype | WBPhenotype:0000005 | Paper_evidence | WBPaper00041908 | |||||
Curator_confirmed | WBPerson8467 | ||||||||
Remark | >50% of eggs laid are at early stages of development (8 cells or less) | Paper_evidence | WBPaper00041908 | ||||||
Curator_confirmed | WBPerson8467 | ||||||||
WBPhenotype:0004008 | Paper_evidence | WBPaper00005799 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | spicule protraction constitutive | Paper_evidence | WBPaper00005799 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00005799 | ||||
Curator_confirmed | WBPerson625 | ||||||||
Reference | WBPaper00041908 | ||||||||
WBPaper00005799 | |||||||||
Method | Substitution_allele |