WormBase Tree Display for Variation: WBVar00249025
expand all nodes | collapse all nodes | view schema
WBVar00249025 | Evidence | Paper_evidence | WBPaper00035599 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy644 | |||||
Other_name | CE05731:p.Gln362Ter | ||||||
F25H8.6.1:c.1084C>T | |||||||
HGVSg | CHROMOSOME_IV:g.9919662C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F25H8 | |||
Flanking_sequences | aaaattgaagatgatcataaaattcatatg | aggtaaaatttgcgttaaataatttcaaat | |||||
Mapping_target | F25H8 | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00009133 | |||||
Transcript | F25H8.6.1 | VEP_consequence | stop_gained,splice_region_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F25H8.6.1:c.1084C>T | ||||||
HGVSp | CE05731:p.Gln362Ter | ||||||
cDNA_position | 1107 | ||||||
CDS_position | 1084 | ||||||
Protein_position | 362 | ||||||
Exon_number | 5/10 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00035599 | |||
Genetics | Interpolated_map_position | IV | 4.44685 | ||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035599 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | bed-3 mutations caused an Egl (egg-laying defective) phenotype | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000111 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | bed-3(sy644) affected the vulval expression pattern of cdh-3::cfp | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Granddaughters of P5.p, P6.p and P7.p often failed to divide in bed-3 mutants | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Pvl | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035599 | ||||||
Method | Substitution_allele |