WormBase Tree Display for Variation: WBVar00248994
expand all nodes | collapse all nodes | view schema
WBVar00248994 | Evidence | Paper_evidence | WBPaper00024662 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy441 | |||||||
Other_name | Y53C10A.12.1:c.1754G>A | ||||||||
CE22380:p.Trp585Ter | |||||||||
Y53C10A.12.2:c.1754G>A | |||||||||
HGVSg | CHROMOSOME_I:g.11955492C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y53C10A | |||||
Flanking_sequences | gtttcagagatttagtcagtaatcataatt | ggatgattttgggaataatgtaccgttgga | |||||||
Mapping_target | Y53C10A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024662 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | PS | ||||||||
DCD | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002004 | |||||||
Transcript | Y53C10A.12.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y53C10A.12.2:c.1754G>A | ||||||||
HGVSp | CE22380:p.Trp585Ter | ||||||||
cDNA_position | 1926 | ||||||||
CDS_position | 1754 | ||||||||
Protein_position | 585 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y53C10A.12.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y53C10A.12.1:c.1754G>A | ||||||||
HGVSp | CE22380:p.Trp585Ter | ||||||||
cDNA_position | 1776 | ||||||||
CDS_position | 1754 | ||||||||
Protein_position | 585 | ||||||||
Exon_number | 8/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (17) | |||||||||
Genetics | Interpolated_map_position | I | 13.0128 | ||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | ||||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00040863 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | hsf-1(sy441) mutant animals displayed an induction of ftn-1 mRNA expression in response to 25 millimolar iron (ferric ammonium citrate) similar to that of wild type animals (Figure S1A). | Paper_evidence | WBPaper00040863 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003020 | Paper_evidence | WBPaper00040863 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were treated with iron (25 millimolar ferric ammonium citrate, FAC) and ftn-1 transcript levels measured by qRT-PCR | Paper_evidence | WBPaper00040863 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00049307 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "skn-1, hsf-1, trx-1 mutants did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) increased hypoxic survival." (Figure S3a) | Paper_evidence | WBPaper00049307 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gcIs30 [Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (18) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |