WormBase Tree Display for Variation: WBVar00248970
expand all nodes | collapse all nodes | view schema
WBVar00248970 | Evidence | Paper_evidence | WBPaper00003017 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy326 | |||||||
Other_name (11) | |||||||||
HGVSg | CHROMOSOME_I:g.5039818_5039819delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | C46H11 | |||||
Flanking_sequences | ttgtttttgatacggaaaaagtgggatgct | atgattgactttgcaaagagttcaccggtt | |||||||
Mapping_target | C46H11 | ||||||||
Type_of_mutation | Substitution | gg | rr | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030843 | ||||||||
WBStrain00030855 | |||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002979 | |||||||
Transcript | C46H11.4f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4f.1:c.1061_1062delinsAA | ||||||||
HGVSp | CE52138:p.Trp354Ter | ||||||||
cDNA_position | 1147-1148 | ||||||||
CDS_position | 1061-1062 | ||||||||
Protein_position | 354 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
C46H11.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4c.1:c.1169_1170delinsAA | ||||||||
HGVSp | CE27864:p.Trp390Ter | ||||||||
cDNA_position | 1225-1226 | ||||||||
CDS_position | 1169-1170 | ||||||||
Protein_position | 390 | ||||||||
Exon_number | 10/12 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
C46H11.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4a.1:c.1268_1269delinsAA | ||||||||
HGVSp | CE27862:p.Trp423Ter | ||||||||
cDNA_position | 1505-1506 | ||||||||
CDS_position | 1268-1269 | ||||||||
Protein_position | 423 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
C46H11.4f.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4f.2:c.1061_1062delinsAA | ||||||||
HGVSp | CE52138:p.Trp354Ter | ||||||||
cDNA_position | 1092-1093 | ||||||||
CDS_position | 1061-1062 | ||||||||
Protein_position | 354 | ||||||||
Exon_number | 8/10 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
C46H11.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4e.1:c.1208_1209delinsAA | ||||||||
HGVSp | CE43449:p.Trp403Ter | ||||||||
cDNA_position | 1208-1209 | ||||||||
CDS_position | 1208-1209 | ||||||||
Protein_position | 403 | ||||||||
Exon_number | 9/10 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
C46H11.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C46H11.4b.1:c.968_969delinsAA | ||||||||
HGVSp | CE27863:p.Trp323Ter | ||||||||
cDNA_position | 1113-1114 | ||||||||
CDS_position | 968-969 | ||||||||
Protein_position | 323 | ||||||||
Exon_number | 7/9 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000519152 | ||||||||
WBInteraction000576763 | |||||||||
Genetics | Interpolated_map_position | I | -0.42336 | ||||||
Mapping_data | In_multi_point | 4474 | |||||||
Description | Phenotype | WBPhenotype:0000145 | Paper_evidence | WBPaper00003017 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | suppresses let-23 sterilty (ovulation) | Paper_evidence | WBPaper00003017 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Genotype | let-23(sy10) | Paper_evidence | WBPaper00003017 | |||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00042394 | |||||||
Curator_confirmed | WBPerson1777 | ||||||||
Remark | Decreased brood size as compared to wildtype | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
WBPhenotype:0000666 | Paper_evidence | WBPaper00042394 | |||||||
Curator_confirmed | WBPerson1777 | ||||||||
Remark | Marginally increased intensity of calcium signaling in spermatheca that is variable from animal to animal, which may suggest incomplete penetrance. | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00028479 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 6A | Paper_evidence | WBPaper00028479 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00028886 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000666 | Paper_evidence | WBPaper00042394 | |||||||
Curator_confirmed | WBPerson1777 | ||||||||
Remark | No obvious ovulation or spermatheca transit defects | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00046355 | |||||||
Curator_confirmed | WBPerson51 | ||||||||
Remark | Figure 1G | Paper_evidence | WBPaper00046355 | ||||||
Curator_confirmed | WBPerson51 | ||||||||
EQ_annotations | GO_term | GO:0016246 | PATO:0000460 | Paper_evidence | WBPaper00046355 | ||||
Curator_confirmed | WBPerson51 | ||||||||
Reference | WBPaper00028886 | ||||||||
WBPaper00028479 | |||||||||
WBPaper00003017 | |||||||||
WBPaper00042394 | |||||||||
WBPaper00046355 | |||||||||
Method | Substitution_allele |