WormBase Tree Display for Variation: WBVar00248954
expand all nodes | collapse all nodes | view schema
| WBVar00248954 | Evidence | Paper_evidence | WBPaper00003822 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sy272 | |||||
| Other_name | CE09704:p.Gln469Ter | ||||||
| F26G5.9.1:c.1405C>T | |||||||
| HGVSg | CHROMOSOME_V:g.4960620G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26G5 | |||
| Flanking_sequences | ggccatcctccaccgatgcatcatcaaatg | aacaaggtccaccgcgtatgatgtatatgc | |||||
| Mapping_target | F26G5 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003822 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | PS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006523 | |||||
| Transcript | F26G5.9.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F26G5.9.1:c.1405C>T | ||||||
| HGVSp | CE09704:p.Gln469Ter | ||||||
| cDNA_position | 1513 | ||||||
| CDS_position | 1405 | ||||||
| Protein_position | 469 | ||||||
| Exon_number | 6/9 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | V | -3.66253 | ||||
| Description | Phenotype | WBPhenotype:0002438 | Paper_evidence | WBPaper00003822 | |||
| Curator_confirmed | WBPerson625 | ||||||
| Remark | reduction in the activity of numerous highly repeated transgenes. | Paper_evidence | WBPaper00003822 | ||||
| Curator_confirmed | WBPerson625 | ||||||
| Reference | WBPaper00003822 | ||||||
| Method | Substitution_allele |
