WormBase Tree Display for Variation: WBVar00248949
expand all nodes | collapse all nodes | view schema
WBVar00248949 | Evidence | Paper_evidence | WBPaper00004273 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy247 | |||||||
Other_name | CE43742:p.Gln528Ter | ||||||||
C01C7.1b.1:c.1582C>T | |||||||||
CE26967:p.Gln528Ter | |||||||||
C01C7.1a.1:c.1582C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.12626375G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01C7 | |||||
Flanking_sequences | tcatcgtcaccgtcaacgtcgagaggatca | aagcttcgcctgcgccttctcatgttagtt | |||||||
Mapping_target | C01C7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004273 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030839 | ||||||||
WBStrain00030876 | |||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000186 | |||||||
Transcript | C01C7.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01C7.1a.1:c.1582C>T | ||||||||
HGVSp | CE26967:p.Gln528Ter | ||||||||
cDNA_position | 1638 | ||||||||
CDS_position | 1582 | ||||||||
Protein_position | 528 | ||||||||
Exon_number | 8/14 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01C7.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01C7.1b.1:c.1582C>T | ||||||||
HGVSp | CE43742:p.Gln528Ter | ||||||||
cDNA_position | 1638 | ||||||||
CDS_position | 1582 | ||||||||
Protein_position | 528 | ||||||||
Exon_number | 8/14 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000006001 | ||||||||
WBInteraction000006002 | |||||||||
WBInteraction000006003 | |||||||||
WBInteraction000006004 | |||||||||
WBInteraction000006005 | |||||||||
WBInteraction000006006 | |||||||||
WBInteraction000006007 | |||||||||
WBInteraction000006008 | |||||||||
WBInteraction000006009 | |||||||||
WBInteraction000006010 | |||||||||
WBInteraction000006011 | |||||||||
WBInteraction000006012 | |||||||||
WBInteraction000006013 | |||||||||
WBInteraction000006014 | |||||||||
WBInteraction000006015 | |||||||||
WBInteraction000006016 | |||||||||
WBInteraction000006017 | |||||||||
WBInteraction000006018 | |||||||||
WBInteraction000500501 | |||||||||
WBInteraction000503721 | |||||||||
WBInteraction000520040 | |||||||||
Genetics | Interpolated_map_position | IV | 6.12245 | ||||||
Description | Phenotype | WBPhenotype:0000414 | Paper_evidence | WBPaper00004273 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | cell fate transformation | Paper_evidence | WBPaper00004273 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004273 | ||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00004273 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | additional vulval differentiation | Paper_evidence | WBPaper00004273 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004273 | ||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00004273 | ||||||||
WBPaper00031110 | |||||||||
Method | Substitution_allele |