WormBase Tree Display for Variation: WBVar00248788
expand all nodes | collapse all nodes | view schema
| WBVar00248788 | Evidence | Paper_evidence | WBPaper00005261 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | st579 | |||||||
| Other_name | C29F9.7.1:c.170G>A | ||||||||
| CE19706:p.Trp57Ter | |||||||||
| HGVSg | CHROMOSOME_III:g.94072C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C29F9 | |||||
| Flanking_sequences | gagacgatcacgccttctcactgctccact | ggccgcgaagggcggccacgtggcgattgc | |||||||
| Mapping_target | C29F9 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005261 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | RW | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003931 | |||||||
| Transcript | C29F9.7.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C29F9.7.1:c.170G>A | ||||||||
| HGVSp | CE19706:p.Trp57Ter | ||||||||
| cDNA_position | 176 | ||||||||
| CDS_position | 170 | ||||||||
| Protein_position | 57 | ||||||||
| Exon_number | 3/10 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Genetics | Interpolated_map_position | III | -26.9857 | ||||||
| Description | Phenotype | WBPhenotype:0000053 | Paper_evidence | WBPaper00001894 | |||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| Remark | Severe Pat phenotype: Embryos are paralyzed at the 1.5-fold stage. | Paper_evidence | WBPaper00001894 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| severe Pat phenotype; all similar to st552 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000015 | PATO:0000460 | Paper_evidence | WBPaper00001894 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001570 | Paper_evidence | WBPaper00001894 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants have actin staining that often appears fibrous and disorganized. | Paper_evidence | WBPaper00001894 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00001894 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000015 | PATO:0000460 | Paper_evidence | WBPaper00001894 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | antibody staining with anti-actin | Paper_evidence | WBPaper00001894 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001396 | Paper_evidence | WBPaper00001894 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Pharyngeal pumping movements were observed in mutants. | Paper_evidence | WBPaper00001894 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000015 | PATO:0000460 | Paper_evidence | WBPaper00001894 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00001894 | ||||||||
| Method | Substitution_allele |
