WormBase Tree Display for Variation: WBVar00242659
expand all nodes | collapse all nodes | view schema
| WBVar00242659 | Evidence | Paper_evidence | WBPaper00006149 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sb115 | |||||||
| Other_name | F52B10.1b.1:c.1417C>T | ||||||||
| F52B10.1a.1:c.1438C>T | |||||||||
| CE31177:p.Gln480Ter | |||||||||
| CE04618:p.Gln473Ter | |||||||||
| HGVSg | CHROMOSOME_X:g.2912465C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F52B10 | |||||
| Flanking_sequences | tttgaaatttttgatatcaattcatttgaa | aaatttgcattaactatacaaacgagaaac | |||||||
| Mapping_target | F52B10 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006149 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00008459 | ||||||||
| Laboratory | HR | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003776 | |||||||
| Transcript | F52B10.1a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F52B10.1a.1:c.1438C>T | ||||||||
| HGVSp | CE31177:p.Gln480Ter | ||||||||
| cDNA_position | 1467 | ||||||||
| CDS_position | 1438 | ||||||||
| Protein_position | 480 | ||||||||
| Exon_number | 10/21 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| F52B10.1b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F52B10.1b.1:c.1417C>T | ||||||||
| HGVSp | CE04618:p.Gln473Ter | ||||||||
| cDNA_position | 1445 | ||||||||
| CDS_position | 1417 | ||||||||
| Protein_position | 473 | ||||||||
| Exon_number | 9/20 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Genetics | Interpolated_map_position | X | -12.6735 | ||||||
| Description | Phenotype | WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Remark | 3° dendrites that fail to self-avoid and overgrow one another. Fig 6D. | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Reference | WBPaper00006149 | ||||||||
| WBPaper00056964 | |||||||||
| Method | Substitution_allele |
