WormBase Tree Display for Variation: WBVar00242658
expand all nodes | collapse all nodes | view schema
WBVar00242658 | Evidence | Paper_evidence | WBPaper00006149 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sb113 | |||||||
Other_name | CE04618:p.Gly640Glu | ||||||||
CE31177:p.Gly647Glu | |||||||||
F52B10.1a.1:c.1940G>A | |||||||||
F52B10.1b.1:c.1919G>A | |||||||||
HGVSg | CHROMOSOME_X:g.2913021G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F52B10 | |||||
Flanking_sequences | agactgcatttggaatgaggtctcgcaagg | aatgttccgaactgtctcgcaattgcacaa | |||||||
Mapping_target | F52B10 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006149 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | HR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003776 | |||||||
Transcript | F52B10.1a.1 (12) | ||||||||
F52B10.1b.1 (12) | |||||||||
Interactor | WBInteraction000501466 | ||||||||
Genetics | Interpolated_map_position | X | -12.6734 | ||||||
Description | Phenotype | WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | 3° dendrites that fail to self-avoid and overgrow one another. Fig 6D. | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Reference | WBPaper00006149 | ||||||||
WBPaper00056964 | |||||||||
Method | Substitution_allele |