WormBase Tree Display for Variation: WBVar00242392
expand all nodes | collapse all nodes | view schema
| WBVar00242392 | Evidence | Paper_evidence | WBPaper00004772 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | s2795 | |||||
| Other_name | CE47418:p.Gln867Ter | ||||||
| K12H4.8.1:c.2599C>T | |||||||
| HGVSg | CHROMOSOME_III:g.8076425G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | K12H4 | |||
| Flanking_sequences | ccacgtattccaaaagatgaagttcgtcgt | aatacaaattcaacgctgaagattataagg | |||||
| Mapping_target | K12H4 | ||||||
| Type_of_mutation | Substitution | c | t | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000864 | ||||||
| Laboratory | BC | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000939 | |||||
| Transcript | K12H4.8.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | K12H4.8.1:c.2599C>T | ||||||
| HGVSp | CE47418:p.Gln867Ter | ||||||
| cDNA_position | 2606 | ||||||
| CDS_position | 2599 | ||||||
| Protein_position | 867 | ||||||
| Exon_number | 16/29 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | III | -0.385884 | ||||
| Description | Phenotype | WBPhenotype:0000745 | Paper_evidence | WBPaper00024573 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | In dcr-1 mutant animals lacZ of pkIs2084 is reactivated in the adult, where in control animals it is silenced. | Paper_evidence | WBPaper00024573 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00004772 | ||||||
| WBPaper00024573 | |||||||
| Method | Substitution_allele |
