WormBase Tree Display for Variation: WBVar00241650

WBVar00241650 Name: Public_name: rx1
    Other_name (12)
    HGVSg: CHROMOSOME_X:g.10797703_10799671del
  Sequence_details: SMap: S_parent: Sequence: F31B12
    Flanking_sequences: gcgtttggttaaattgcttcaagcgggtgc ttggcacttggatacgtacgaatcagctga
    Mapping_target: F31B12
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030933
    Laboratory: KF
    Status: Live
  Affects: Gene: WBGene00004036
    Transcript (12)
    Interactor: WBInteraction000521593
  Genetics: Interpolated_map_position: X 2.53561
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00042394
        Curator_confirmed: WBPerson1777
      WBPhenotype:0000666 Paper_evidence: WBPaper00042394
        Curator_confirmed: WBPerson1777
        Remark: Embryos are retained in the spermatheca and fail to exit into the uterus following fertilization. Paper_evidence: WBPaper00042394
            Curator_confirmed: WBPerson1777
          Fail to produce calcium signals following oocyte entry into the spermatheca. Do not produce initial pulse of calcium in the sp-ut valve during ovulation. Paper_evidence: WBPaper00042394
            Curator_confirmed: WBPerson1777
        EQ_annotations: Anatomy_term: WBbt:0006756 PATO:0000460 Paper_evidence: WBPaper00042394
                Curator_confirmed: WBPerson1777
            WBbt:0005319 PATO:0000460 Paper_evidence: WBPaper00042394
                Curator_confirmed: WBPerson1777
          GO_term: GO:0030728 PATO:0000460 Paper_evidence: WBPaper00042394
                Curator_confirmed: WBPerson1777
  Reference: WBPaper00042394
  Remark: This deletion removes 45% of the genomic region of the Y domain and the entire C2 and RA1 domains. Paper_evidence: WBPaper00024374
  Method: Deletion_allele