WormBase Tree Display for Variation: WBVar00241638
expand all nodes | collapse all nodes | view schema
WBVar00241638 | Evidence | Paper_evidence | WBPaper00032102 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rt68 | |||||||
Other_name | F11C7.5.1:c.530delinsA | ||||||||
F11C7.5.2:c.530delinsA | |||||||||
CE17657:p.Trp177Ter | |||||||||
HGVSg | CHROMOSOME_X:g.17420796delinsT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F11C7 | |||||
Flanking_sequences | ccgctgccatggccgagacttgccaacgtt | tactccaagtgcaccatgttcactccagtg | |||||||
Mapping_target | F11C7 | ||||||||
Type_of_mutation | Substitution | gg | rr | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | HA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003891 | |||||||
Transcript | F11C7.5.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11C7.5.1:c.530delinsA | ||||||||
HGVSp | CE17657:p.Trp177Ter | ||||||||
cDNA_position | 591-592 | ||||||||
CDS_position | 530-531 | ||||||||
Protein_position | 177 | ||||||||
Exon_number | 3/4 | ||||||||
Codon_change | tGG/tAG | ||||||||
Amino_acid_change | W/* | ||||||||
F11C7.5.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F11C7.5.2:c.530delinsA | ||||||||
HGVSp | CE17657:p.Trp177Ter | ||||||||
cDNA_position | 594-595 | ||||||||
CDS_position | 530-531 | ||||||||
Protein_position | 177 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | tGG/tAG | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | X | 24.0914 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 57% of animals retain eggs. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000071 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a low frequency of head defects. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are slightly smaller than wild-type animals. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although egl-17p::gfp expression in the P6.p cell was similar to control animals, egl-17p::gfp expression was ectopic in approximately 10% of osm-11(lf) L3 animals and was lost in P5.p and/or P7.p descendents in 71% of L4 animals, consistent with the incorrect specification of primary and secondary cell fates. Secondary cell fates were lost as determined by the loss of lin-11p::gfp expression in P5.p and/or P7.p descendents in 67% of osm-11(lf) animals. Finally, lip-1p::GFP expression was not upregulated in P5p and/or P7.p in 35% of animals unlike in wild-type animals. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | lin-3p::gfp or egl-17::gfp or lin-11p::GFP or lip-1p::GFP | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000453 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Two-thirds of animals had a ventral protrusion behind the anus. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit a slightly slower growth rate compared to wild-type animals. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 15% of animals exhibit a misshapen vulva. Neuronal expression of osm-11cDNA significantly rescued these vulval defects to levels comparable with osm-11 promoter driven cDNA, in addition hypodermal expression of osm-11cDNA also rescued these defects, although to a lower level. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs4 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 42% of animals exhibit a protruding vulva. Neuronal expression of osm-11cDNA significantly rescued these vulval defects to levels comparable with osm-11 promoter driven cDNA, in addition hypodermal expression of osm-11cDNA also rescued these defects, although to a lower level. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs4 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit vulval perturbations. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs4[lip-1p::gfp] | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001096 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 12% of animals exhibit an extra protrusion near the normally positioned vulva. Neuronal expression of osm-11cDNA significantly rescued these vulval defects to levels comparable with osm-11 promoter driven cDNA, in addition hypodermal expression of osm-11cDNA also rescued these defects, although to a lower level. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs4 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000145 | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | AC cell fate specification was not altered in comparison to osm-11(+) animals as determined by the pattern of lin-3p::GFP expression. | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00032102 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | lin-3p::gfp | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032102 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032102 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003891 Amber_UAG_or_Opal_UGA | ||||||||
Method | Substitution_allele |