WormBase Tree Display for Variation: WBVar00241620
expand all nodes | collapse all nodes | view schema
WBVar00241620 | Evidence | Paper_evidence | WBPaper00013472 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | rm1 | ||||||
Other_name | C32E12.3.1:c.365-1G>A | |||||||
HGVSg | CHROMOSOME_I:g.5202802C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C32E12 | ||||
Flanking_sequences | taactgttctgaaaacaaatttgaatttca | gaaatgcatttatcgatatgttgaatggaa | ||||||
Mapping_target | C32E12 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000175 | |||||||
Laboratory | AM | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00016329 | ||||||
Transcript | C32E12.3.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C32E12.3.1:c.365-1G>A | |||||||
Intron_number | 3/9 | |||||||
Genetics | Interpolated_map_position | I | -0.274236 | |||||
Description | Phenotype | WBPhenotype:0000876 | Paper_evidence | WBPaper00032037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are more resistant to stress in general, but also show less variation in stress response throughout the day as demonstrated by tap responsiveness after exposure to 350 mM NaCl. Diurnal variation of osmotic stress tolerence is present when higher concentrations of NaCl is used. | Paper_evidence | WBPaper00032037 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were maintained at 16C under 12:12 h light:dark conditions. For testing, synchronized cultures of L1 larva were maintained without food for 3 days and entrained to LD conditions. Worms were fed with E.coli and kept at a final concentration of 15 worms/10ul at 25C. 50uM fluorodeoxyuridine (FuDR) was added when worms were L4. | Paper_evidence | WBPaper00032037 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001710 | Paper_evidence | WBPaper00032037 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show less variation in stress response throughout the day as demonstrated by tap responsiveness after exposure to 350 mM NaCl. Diurnal stress response is restored at higher concentrations of NaCl. | Paper_evidence | WBPaper00032037 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were maintained at 16C under 12:12 h light:dark conditions. For testing, synchronized cultures of L1 larva were maintained without food for 3 days and entrained to LD conditions. Worms were fed with E.coli and kept at a final concentration of 15 worms/10ul at 25C. 50uM fluorodeoxyuridine (FuDR) was added when worms were L4. | Paper_evidence | WBPaper00032037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032037 | |||||||
Method | Substitution_allele |