WormBase Tree Display for Variation: WBVar00241606

WBVar00241606 Evidence: Paper_evidence: WBPaper00004627
  Name: Public_name: rh319
    Other_name: F15G9.4f.1:c.2329C>T
      CE18595:p.Gln875Ter
      CE18596:p.Gln875Ter
      F15G9.4d.1:c.2623C>T
      F15G9.4b.1:c.2623C>T
      F15G9.4a.1:c.2623C>T
      CE53379:p.Gln875Ter
      CE53181:p.Gln777Ter
      CE53340:p.Gln777Ter
      F15G9.4e.1:c.2329C>T
    HGVSg: CHROMOSOME_X:g.9722440C>T
  Sequence_details: SMap: S_parent: Sequence: F15G9
    Flanking_sequences: attgcaagaaacacatacggacaacaatct aatctacgacacttatggtaaccggattgg
    Mapping_target: F15G9
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00004627
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00003952
    Laboratory: NJ
    Status: Live
  Affects: Gene: WBGene00001863
    Transcript: F15G9.4b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15G9.4b.1:c.2623C>T
        HGVSp: CE18596:p.Gln875Ter
        cDNA_position: 2684
        CDS_position: 2623
        Protein_position: 875
        Exon_number: 9/64
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      F15G9.4f.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15G9.4f.1:c.2329C>T
        HGVSp: CE53340:p.Gln777Ter
        cDNA_position: 2329
        CDS_position: 2329
        Protein_position: 777
        Exon_number: 7/61
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      F15G9.4e.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15G9.4e.1:c.2329C>T
        HGVSp: CE53181:p.Gln777Ter
        cDNA_position: 2329
        CDS_position: 2329
        Protein_position: 777
        Exon_number: 7/61
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      F15G9.4d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15G9.4d.1:c.2623C>T
        HGVSp: CE53379:p.Gln875Ter
        cDNA_position: 2623
        CDS_position: 2623
        Protein_position: 875
        Exon_number: 8/46
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      F15G9.4a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15G9.4a.1:c.2623C>T
        HGVSp: CE18595:p.Gln875Ter
        cDNA_position: 2623
        CDS_position: 2623
        Protein_position: 875
        Exon_number: 8/63
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000502202
  Genetics: Interpolated_map_position: X 1.45996
  Description: Phenotype: WBPhenotype:0000504 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: Analysis of FISH experiments reveal a variety of abnormal karyotypes in germ cells throughout the gonad in him-4(rh319) mutant animals. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00038412
                Curator_confirmed: WBPerson712
      WBPhenotype:0001652 Paper_evidence: WBPaper00035117
        Curator_confirmed: WBPerson2021
        Remark: Null mutations in hemicentin (him-4) cause a moderate invasion defect Paper_evidence: WBPaper00035117
            Curator_confirmed: WBPerson2021
        Variation_effect: Null: Paper_evidence: WBPaper00035117
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001882 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: Examination of oocytes in diakinesis indicates that the aneuploidy observed in him-4 mutant animals can affect all 5 autosomes in addition to the X chromosome and may include massive aneuploidy and more subtle 'near diploid' defects in chromosome number. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
      WBPhenotype:0001951 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: Pachytene nuclei are generally larger than those found in wild-type animals and chromosome numbers are frequently elevated. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00038412
                Curator_confirmed: WBPerson712
      WBPhenotype:0001972 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: Large numbers of multinucleate cells are observed among mitotic germ cells in mutant gonads. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
      WBPhenotype:0002040 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: A significant fraction (14%) of mitotic germ cells have multipolar spindles that are not observed in a wild-type background. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00038412
                Curator_confirmed: WBPerson712
      WBPhenotype:0002162 Paper_evidence: WBPaper00038412
        Curator_confirmed: WBPerson712
        Remark: A significant fraction (14%) of mitotic germ cells have multipolar spindles that are not observed in a wild-type background. Paper_evidence: WBPaper00038412
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00038412
                Curator_confirmed: WBPerson712
  Reference: WBPaper00038412
    WBPaper00035117
  Method: Substitution_allele