WormBase Tree Display for Variation: WBVar00241606
expand all nodes | collapse all nodes | view schema
WBVar00241606 | Evidence | Paper_evidence | WBPaper00004627 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F15G9 | |||||
Flanking_sequences | attgcaagaaacacatacggacaacaatct | aatctacgacacttatggtaaccggattgg | |||||||
Mapping_target | F15G9 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004627 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003952 | ||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001863 | |||||||
Transcript | F15G9.4b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15G9.4b.1:c.2623C>T | ||||||||
HGVSp | CE18596:p.Gln875Ter | ||||||||
cDNA_position | 2684 | ||||||||
CDS_position | 2623 | ||||||||
Protein_position | 875 | ||||||||
Exon_number | 9/64 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F15G9.4f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15G9.4f.1:c.2329C>T | ||||||||
HGVSp | CE53340:p.Gln777Ter | ||||||||
cDNA_position | 2329 | ||||||||
CDS_position | 2329 | ||||||||
Protein_position | 777 | ||||||||
Exon_number | 7/61 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F15G9.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15G9.4e.1:c.2329C>T | ||||||||
HGVSp | CE53181:p.Gln777Ter | ||||||||
cDNA_position | 2329 | ||||||||
CDS_position | 2329 | ||||||||
Protein_position | 777 | ||||||||
Exon_number | 7/61 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F15G9.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15G9.4d.1:c.2623C>T | ||||||||
HGVSp | CE53379:p.Gln875Ter | ||||||||
cDNA_position | 2623 | ||||||||
CDS_position | 2623 | ||||||||
Protein_position | 875 | ||||||||
Exon_number | 8/46 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F15G9.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15G9.4a.1:c.2623C>T | ||||||||
HGVSp | CE18595:p.Gln875Ter | ||||||||
cDNA_position | 2623 | ||||||||
CDS_position | 2623 | ||||||||
Protein_position | 875 | ||||||||
Exon_number | 8/63 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000502202 | ||||||||
Genetics | Interpolated_map_position | X | 1.45996 | ||||||
Description | Phenotype | WBPhenotype:0000504 | Paper_evidence | WBPaper00038412 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Analysis of FISH experiments reveal a variety of abnormal karyotypes in germ cells throughout the gonad in him-4(rh319) mutant animals. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00038412 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00035117 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Null mutations in hemicentin (him-4) cause a moderate invasion defect | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001882 | Paper_evidence | WBPaper00038412 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Examination of oocytes in diakinesis indicates that the aneuploidy observed in him-4 mutant animals can affect all 5 autosomes in addition to the X chromosome and may include massive aneuploidy and more subtle 'near diploid' defects in chromosome number. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001951 | Paper_evidence | WBPaper00038412 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pachytene nuclei are generally larger than those found in wild-type animals and chromosome numbers are frequently elevated. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00038412 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001972 | Paper_evidence | WBPaper00038412 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Large numbers of multinucleate cells are observed among mitotic germ cells in mutant gonads. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002040 | Paper_evidence | WBPaper00038412 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A significant fraction (14%) of mitotic germ cells have multipolar spindles that are not observed in a wild-type background. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00038412 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002162 | Paper_evidence | WBPaper00038412 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A significant fraction (14%) of mitotic germ cells have multipolar spindles that are not observed in a wild-type background. | Paper_evidence | WBPaper00038412 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00038412 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038412 | ||||||||
WBPaper00035117 | |||||||||
Method | Substitution_allele |