WormBase Tree Display for Variation: WBVar00241332
expand all nodes | collapse all nodes | view schema
| WBVar00241332 | Evidence | Paper_evidence | WBPaper00005804 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | r367ra233 | |||||
| Other_name | C47E8.7.1:c.283G>A | ||||||
| CE05443:p.Glu95Lys | |||||||
| HGVSg | CHROMOSOME_V:g.14694935C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C47E8 | |||
| Flanking_sequences | acacaattggagttcacaccaatgcataaa | aagcaagaattcagttaccagatatgcaaa | |||||
| Mapping_target | C47E8 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005804 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TR | ||||||
| DM | |||||||
| Status | Live | ||||||
| Linked_to | WBVar00241329 | ||||||
| Affects | Gene | WBGene00006836 | |||||
| Transcript | C47E8.7.1 (12) | ||||||
| Genetics | Interpolated_map_position | V | 6.70021 | ||||
| Reference | WBPaper00005804 | ||||||
| Remark | ra233 is a revertant of r367. The allele alteration is same as the revertants ra202 and ra236 | Paper_evidence | WBPaper00005804 | ||||
| Cis double mutant | |||||||
| Method | Substitution_allele |
