WormBase Tree Display for Variation: WBVar00241329

WBVar00241329 Evidence: Paper_evidence: WBPaper00005804
  Name: Public_name: r367
    Other_name: C47E8.7.1:c.254C>T
      CE05443:p.Thr85Ile
    HGVSg: CHROMOSOME_V:g.14694964G>A
  Sequence_details: SMap: S_parent: Sequence: C47E8
    Flanking_sequences: ctcttgaccagaatggaattacagctgaaa acaattggagttcacaccaatgcataaaga
    Mapping_target: C47E8
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (12)
    Laboratory: TR
    Status: Live
  Linked_to: WBVar00241330
    WBVar00241331
    WBVar00241332
    WBVar00241333
  Affects: Gene: WBGene00006836
    Transcript: C47E8.7.1 (12)
    Interactor: WBInteraction000501326
      WBInteraction000501327
      WBInteraction000518971
      WBInteraction000519427
      WBInteraction000519460
      WBInteraction000519461
      WBInteraction000519462
      WBInteraction000519463
      WBInteraction000519464
  Genetics: Interpolated_map_position: V 6.70023
  Description: Phenotype: WBPhenotype:0000164 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Adults thin except for head region. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000181 Paper_evidence: WBPaper00031671
        Curator_confirmed: WBPerson2021
        Remark: In unc-112 mutants, 9% of the NSM sub-ventral processes are short Paper_evidence: WBPaper00031671
            Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0003666 PATO:0000460 Paper_evidence: WBPaper00031671
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: zdIs13 [ tph-1p::GFP] Paper_evidence: WBPaper00031671
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000640 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00040652
        Curator_confirmed: WBPerson712
        Remark: Although the unc-112ts mutants are not fully normal in movement rate even when grown at the ''permissive'' 16 degC, they show a pronounced loss of mobility within 24 h after ashift to 25 degC. Paper_evidence: WBPaper00040652
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00040652
          Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
      WBPhenotype:0000644 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Adults paralysed. Easy to score (ES3) in adults. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Ease_of_scoring: ES3_Easy_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000926 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Disorganized body wall muscle, frayed myofilament lattice; young larvae nearly wild type (phenotypes very similar to unc-52). Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001401 Paper_evidence: WBPaper00040652
        Curator_confirmed: WBPerson712
        Remark: Severe mitochondrial fragmentation occurs in unc-112ts mutants. Paper_evidence: WBPaper00040652
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00040652
          Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
      WBPhenotype:0001645 Paper_evidence: WBPaper00040652
          WBPaper00040284
        Curator_confirmed: WBPerson712
          WBPerson2987
        Remark: Acute temperature shift of fully developed adult animals results in protein degradation in mutants but not in wild-type animals. Whole body protein, as assessed in triplicate 30 worm samples by coomassie staining and quantified in ImageJ, was reduced in unc-112ts mutants, but not wild-type animals, 48 hours post temperature shift. | The same temperature shift experiments in the presence of the protein synthesis inhibitor cycloheximide (CHx) showed that degradation was occurring by activation of pre-existing protease(s). | Degradation was not prevented by treatment with levamisole (Lev), MG132 (ZLLL), SB201290, or N6,N6-dimethyladenosine. | Acute treatment with calpain inhibitors did suppress protein degradation. Paper_evidence: WBPaper00040652
            Curator_confirmed: WBPerson712
          Table 1 Paper_evidence: WBPaper00040284
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004352 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
            WBMol:00004019 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
            WBMol:00005301 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
            WBMol:00005300 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
            WBMol:00005302 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
            WBMol:00005303 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
      WBPhenotype:0001889 Paper_evidence: WBPaper00040652
        Curator_confirmed: WBPerson712
        Remark: Arrayed sarcomeres were disrupted in unc-112ts mutants. Also actin filaments are torn in fixed unc-112ts mutant animals stained with RITC-phalloidin at 24 hrs post temperature shift. No degradation of either myosin heavy chain or actin was observed in western blots of unc-112ts mutant animals (not shown). Paper_evidence: WBPaper00040652
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00040652
          Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00040652
              Curator_confirmed: WBPerson712
      WBPhenotype:0002142 Paper_evidence: WBPaper00046120
        Curator_confirmed: WBPerson1754
        Remark: Figure 1 B; "MRAP and movement forces were measured in animals possessing either of 2 integrin-adhesome component mutations: unc-52/perlecan or unc-112/kindlin. These mutants were selected because they represent collapse at the level of the extracellularmatrix interface (unc-52) and intracellular interface (unc-112). Both mutants display reduced rates of maximal mitochondrial ATP production with glutamate + succinate as a substrate (667 +/- 428, 294 +/- 212, and 1278 +/- 634 nmol ATP min21 at 25C /mmol acetyl-CoA21 min21 at 30C at 30C for unc-52, unc-112, and wild-type animals, respectively; P , 0.001; Fig. 1B). Maximal ATP production was also significantly reduced in both mutants when glutamate + malate and palmitoyl-l-carnitine + malate were used as mitochondrial substrates (P , 0.05). Only unc-112 mutants displayed lowered maximal ATP production when pyruvate + malate and succinate were used as substrates (P , 0.05)." Paper_evidence: WBPaper00046120
            Curator_confirmed: WBPerson1754
        Phenotype_assay: Genotype: ccIs55(unc-54::lacZ) Paper_evidence: WBPaper00046120
              Curator_confirmed: WBPerson1754
  Reference: WBPaper00040284
    WBPaper00040652
    WBPaper00031671
    WBPaper00023580
    WBPaper00046120
  Method: Substitution_allele