WormBase Tree Display for Variation: WBVar00241315
expand all nodes | collapse all nodes | view schema
| WBVar00241315 | Evidence | Paper_evidence | WBPaper00001234 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | r316 | |||||
| Other_name | CE09349:p.Gln417Ter | ||||||
| F11C3.3.1:c.1249C>T | |||||||
| HGVSg | CHROMOSOME_I:g.14861031G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F11C3 | |||
| Flanking_sequences | gaatgggtatccaagggacagaactgcgaa | aagtcaattgggctgtcggagccatggccaa | |||||
| Mapping_target | F11C3 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001234 | ||
| WBPaper00001813 | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TR | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006789 | |||||
| Transcript | F11C3.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F11C3.3.1:c.1249C>T | ||||||
| HGVSp | CE09349:p.Gln417Ter | ||||||
| cDNA_position | 1281 | ||||||
| CDS_position | 1249 | ||||||
| Protein_position | 417 | ||||||
| Exon_number | 6/11 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | I | 27.9616 | ||||
| Reference | WBPaper00001234 | ||||||
| Remark | Pulak et al (1993) describe this mutation as a C to T transition, Gln420 (Gln417) to Ochre (CAA to TAA). It was previously described as Gln420 (417) to UAG (stop) by Bejsovec et al, 1990.) | ||||||
| Method | Substitution_allele |
