WormBase Tree Display for Variation: WBVar00241315
expand all nodes | collapse all nodes | view schema
WBVar00241315 | Evidence | Paper_evidence | WBPaper00001234 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F11C3 | |||
Flanking_sequences | gaatgggtatccaagggacagaactgcgaa | aagtcaattgggctgtcggagccatggccaa | |||||
Mapping_target | F11C3 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001234 | ||
WBPaper00001813 | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006789 | |||||
Transcript | F11C3.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F11C3.3.1:c.1249C>T | ||||||
HGVSp | CE09349:p.Gln417Ter | ||||||
cDNA_position | 1281 | ||||||
CDS_position | 1249 | ||||||
Protein_position | 417 | ||||||
Exon_number | 6/11 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | I | 27.9616 | ||||
Reference | WBPaper00001234 | ||||||
Remark | Pulak et al (1993) describe this mutation as a C to T transition, Gln420 (Gln417) to Ochre (CAA to TAA). It was previously described as Gln420 (417) to UAG (stop) by Bejsovec et al, 1990.) | ||||||
Method | Substitution_allele |