WormBase Tree Display for Variation: WBVar00241200
expand all nodes | collapse all nodes | view schema
WBVar00241200 | Name | Public_name | qa705 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.7699544_7700978del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T23G11 | |||||
Flanking_sequences | atttaaataaattatactgtacccattcca | ttttcatgcccaatgtgtcagaaacaattt | |||||||
Mapping_target | T23G11 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040603 | ||||||||
WBStrain00040605 | |||||||||
Laboratory | XA | ||||||||
Author | Johnston, WL | ||||||||
Dennis, JW | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001647 | |||||||
Transcript | T23G11.2.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-4/5 | ||||||||
Exon_number | 1-6/6 | ||||||||
Interactor | WBInteraction000050763 | ||||||||
WBInteraction000502664 | |||||||||
WBInteraction000502665 | |||||||||
WBInteraction000502666 | |||||||||
Genetics | Interpolated_map_position | I | 2.2822 | ||||||
Mapping_data | In_multi_point | 4366 | |||||||
Description | Phenotype | WBPhenotype:0000034 | Paper_evidence | WBPaper00028588 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000365 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000777 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001151 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | the sperm pronucleus/centrosome complex fails to associate closely with the cortex | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001168 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | cortical polartity defective as judged by failure to segregate PAR-3 | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001174 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | during meiosis | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | pie-1::GFP::H2B | Paper_evidence | WBPaper00028588 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001178 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | egg shell lacking chitin and other lectin-reactive conjugates | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000776 | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | pie-1::GFP::tubulin | Paper_evidence | WBPaper00028588 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001152 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | maternal and paternal pronuclei decondensed and met with normal timing | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001343 | Paper_evidence | WBPaper00028588 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00028588 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00028588 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | pie-1::GFP::tubulin | Paper_evidence | WBPaper00028588 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00019727 | ||||||||
WBPaper00019728 | |||||||||
WBPaper00010668 | |||||||||
WBPaper00028588 | |||||||||
Method | Deletion_allele |