WormBase Tree Display for Variation: WBVar00241090
expand all nodes | collapse all nodes | view schema
| WBVar00241090 | Evidence | Paper_evidence | WBPaper00003410 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | q370 | |||||||
| Other_name | CE01027:p.Arg330Ter | ||||||||
| K03H1.2.1:c.988C>T | |||||||||
| HGVSg | CHROMOSOME_III:g.9955125G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | K03H1 | |||||
| Flanking_sequences | caaaacattgttcctccattccttgatggt | gaattgttttcactaaacaagcacaaccaa | |||||||
| Mapping_target | K03H1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003410 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | JK | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003389 | |||||||
| Transcript | K03H1.2.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | K03H1.2.1:c.988C>T | ||||||||
| HGVSp | CE01027:p.Arg330Ter | ||||||||
| cDNA_position | 991 | ||||||||
| CDS_position | 988 | ||||||||
| Protein_position | 330 | ||||||||
| Exon_number | 4/9 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| Genetics | Interpolated_map_position | III | 1.36042 | ||||||
| Mapping_data | In_multi_point | 3171 | |||||||
| 3172 | |||||||||
| 3173 | |||||||||
| 3174 | |||||||||
| 3176 | |||||||||
| Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00001710 | |||||
| Curator_confirmed | WBPerson502 | ||||||||
| Remark | Table 6 | Paper_evidence | WBPaper00001710 | ||||||
| Curator_confirmed | WBPerson502 | ||||||||
| WBPhenotype:0000385 | Paper_evidence | WBPaper00001883 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | XX mog mutant adults produce two to five times the normal number of sperm | Paper_evidence | WBPaper00001883 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000683 | Paper_evidence | WBPaper00001883 | |||||||
| WBPaper00003410 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| WBPerson502 | |||||||||
| Remark | Germ cells that would normally become oocytes have been transformed into sperm instead | Paper_evidence | WBPaper00001883 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| hermaphrodite germline makes 300-500 sperm, no oocytes; similar to q223 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| homozygotes have a masculinized germline | Paper_evidence | WBPaper00003410 | |||||||
| Curator_confirmed | WBPerson502 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001360 | Paper_evidence | WBPaper00001883 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00001883 | ||||||||
| WBPaper00001710 | |||||||||
| WBPaper00003410 | |||||||||
| Method | Substitution_allele |
