WormBase Tree Display for Variation: WBVar00241090
expand all nodes | collapse all nodes | view schema
WBVar00241090 | Evidence | Paper_evidence | WBPaper00003410 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q370 | |||||||
Other_name | CE01027:p.Arg330Ter | ||||||||
K03H1.2.1:c.988C>T | |||||||||
HGVSg | CHROMOSOME_III:g.9955125G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K03H1 | |||||
Flanking_sequences | caaaacattgttcctccattccttgatggt | gaattgttttcactaaacaagcacaaccaa | |||||||
Mapping_target | K03H1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003410 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects (2) | |||||||||
Genetics | Interpolated_map_position | III | 1.36042 | ||||||
Mapping_data | In_multi_point | 3171 | |||||||
3172 | |||||||||
3173 | |||||||||
3174 | |||||||||
3176 | |||||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00001710 | |||||
Curator_confirmed | WBPerson502 | ||||||||
Remark | Table 6 | Paper_evidence | WBPaper00001710 | ||||||
Curator_confirmed | WBPerson502 | ||||||||
WBPhenotype:0000385 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | XX mog mutant adults produce two to five times the normal number of sperm | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00001883 | |||||||
WBPaper00003410 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson502 | |||||||||
Remark | Germ cells that would normally become oocytes have been transformed into sperm instead | Paper_evidence | WBPaper00001883 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
hermaphrodite germline makes 300-500 sperm, no oocytes; similar to q223 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
homozygotes have a masculinized germline | Paper_evidence | WBPaper00003410 | |||||||
Curator_confirmed | WBPerson502 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001360 | Paper_evidence | WBPaper00001883 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001883 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001883 | ||||||||
WBPaper00001710 | |||||||||
WBPaper00003410 | |||||||||
Method | Substitution_allele |