WormBase Tree Display for Variation: WBVar00241036
expand all nodes | collapse all nodes | view schema
WBVar00241036 | Evidence | Paper_evidence | WBPaper00001677 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q224 | |||||||
Other_name | CE00237:p.Gly1043Glu | ||||||||
F02A9.6.1:c.3128G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9098521G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | |||||
Flanking_sequences | ctgcattgatgctagtagcacgtgaactcg | aaaacatcaagtggagatggcagagcttct | |||||||
Mapping_target | F02A9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001677 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022516 | ||||||||
WBStrain00022530 | |||||||||
WBStrain00022538 | |||||||||
WBStrain00047329 | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001609 | |||||||
Transcript | F02A9.6.1 (12) | ||||||||
Interactor | WBInteraction000009194 | ||||||||
WBInteraction000502006 | |||||||||
WBInteraction000517590 | |||||||||
WBInteraction000518397 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.163976 | ||||||
Description | Phenotype | WBPhenotype:0000120 | Paper_evidence | WBPaper00038310 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | TFG-1 and CAR-1 levels are significantly reduced at higher temperatures(25 deg C) compared to levels at 15 deg C, as measured by antibody staining. | Paper_evidence | WBPaper00038310 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00031914 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | larp-1 mRNA was reduced, but not absent. | Paper_evidence | WBPaper00031914 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031914 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031914 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000215 | Paper_evidence | WBPaper00040352 | |||||||
Curator_confirmed | WBPerson6693 | ||||||||
Remark | Adult hermaphrodites either had an essentially normal germline [glp-1(q224) grown at 15°C], or had virtually no germline [glp-1(q224) grown at 25°C] | Paper_evidence | WBPaper00040352 | ||||||
Curator_confirmed | WBPerson6693 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040352 | |||||
Curator_confirmed | WBPerson6693 | ||||||||
WBPhenotype:0000275 | Paper_evidence | WBPaper00035429 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | DNA damage accumulates at a faster rate after exposure to UVC. | Paper_evidence | WBPaper00035429 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000286 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Although signs of pharyngeal differentiation is seen within the embryo, morphogenesis is defective, and a recognizable worm is not made. | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00060633 | |||||||
Curator_confirmed | WBPerson37673 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00060633 | ||||||
Curator_confirmed | WBPerson37673 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00060633 | ||||||
Curator_confirmed | WBPerson37673 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000621 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is no detectable excretory cell | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 1 | 1 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005812 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005777 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Only observed when progeny from a homozygous glp-1(g224ts) hermaphrodite are shifted to the restrictive temperature during early embryogenesis | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although dead nematodes were not observed, the UVC-exposed nematodes were sluggish between 24 and 72 hours after exposure. | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | We exposed 1-day-old glp-1 adultsto 400 J/m2 UVC, allowed them to recover for 3 hours to 3 days, and then analyzed lesion frequencies in the polymerase epsilon target (Figure 5). | Paper_evidence | WBPaper00029334 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Only 6-8 germ cells are produced in glp-1 mutants. All these germ cells differentiate into sperm | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00060633 | |||||||
Curator_confirmed | WBPerson37673 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00060633 | ||||||
Curator_confirmed | WBPerson37673 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00060633 | ||||||
Curator_confirmed | WBPerson37673 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00035429 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Global gene expression was highly divergent in the glp-1 strain from either wild-type or xpa-1, in both conditions. | Paper_evidence | WBPaper00035429 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00035429 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals lack germ cells. | Paper_evidence | WBPaper00035429 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00035490 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | glp-1 mutants extended nematode survival in the presence of P. aeruginosa and S. marcescens | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001098 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 1 | 1 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005773 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Only observed when progeny from a homozygous glp-1(g224ts) hermaphrodite are shifted to the restrictive temperature during early embryogenesis | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 1 | 1 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Only observed when progeny from a homozygous glp-1(g224ts) hermaphrodite are shifted to the restrictive temperature during early embryogenesis | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00033205 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RNP-8L protein was absent from glp-1 mutants with no germline | Paper_evidence | WBPaper00033205 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033205 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002120 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No statistically significant removal of mitochondrial lesions was observed (Figure 3b). In N2 the lesion frequency decreased significantly (Figure 3a) in both the nuclear and mitochondrial genomes at 6 and 24 hours. | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0002129 | Paper_evidence | WBPaper00041209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Post-mitotic young adult glp-1 nematodes raised at 25C were exposed to 0-100 J/m2UVC and both nuclear and mtDNA damage was analyzed at 0, 24, 48 and 72 h post exposure via a highly sensitive QPCR assay that does not require differential extraction of nuclear and mtDNA (55,56,69). Over 72 h, 30-40% removal of mtDNA damage was observed at 50 and 100 J/m2 (Figure 1a). nDNA damage was repaired to control level by 72 h (Figure 1b). Poisson distribution of lesions and a similar mtDNA copy number per cell, even at 50 and 100 J/m2 35 and 20%, respectively, of mtDNA genomes would be predicted to remain undamaged. Thus, in principle, the reduction in mtDNA damage observed here could result from dilution of damage rather than removal; however, mtDNA copy number did not increase during the recovery period at any UV dose as measured b real-time PCR (Figure 1c). In fact, there was a significant decrease in copy number across treatments by 48 h post exposure (including controls; Figure 1d); this decrease was not altered by the level of damage (P=0.3246 for treatment time interaction). | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002430 | Paper_evidence | WBPaper00041209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Post-mitotic young adult glp-1 nematodes raised at 25C were exposed to 0-100 J/m2 UVC and both nuclear and mtDNA damage was analyzed at 0, 24, 48 and 72 h post exposure via a highly sensitive QPCR assay that does not require differential extraction of nuclear and mtDNA (55,56,69). Over 72 h, 30-40% removal of mtDNA damage was observed at 50 and 100 J/m2 (Figure 1a). nDNA damage was repaired to control level by 72 h (Figure 1b). Poisson distribution of lesions and a similar mtDNA copy number per cell, even at 50 and 100 J/m2 35 and 20%, respectively, of mtDNA genomes would be predicted to remain undamaged. Thus, in principle, the reduction in mtDNA damage observed here could result from dilution of damage rather than removal; however, mtDNA copy number did not increase during the recovery period at any UV dose as measured b real-time PCR (Figure 1c). In fact, there was a significant decrease in copy number across treatments by 48 h post exposure (including controls; Figure 1d); this decrease wa snot altered by the level of damage (P=0.3246 for treatment time interaction). | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded robustly to octanol. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000739 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Different life stages of N2 or glp-1 nematodes exposed to 0, 100, or 200 J/m2 UVC exhibited marked differences in susceptibility to induction of DNA damage (Figure 2), with starved L1 larvae the most and 1-day-old N2 adults the least susceptible. No differences were observed in terms of damage to the nuclear (DNA polymerase epsilon target) and mitochondrial genome at any life stage. We also compared eggs isolated by bleach-sodium hydroxide treatment but not exposed to UVC, with unexposed eggs isolated by wash-off (eggs already laid), to test whether the bleach-sodium hydroxide treatment had a detectable effect on DNA integrity. No difference was detected (data not shown). | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00022538 | Paper_evidence | WBPaper00029334 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001938 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No detectable difference in repair was observed between the N2 and glp-1 L1 larvae (Figure 4). Removal of nuclear lesions was apparent in glp-1 adults. In N2 the lesion frequency decreased significantly (Figure 3a) in both the nuclear and mitochondrial genomes at 6 and 24 hours. | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0002430 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Different life stages of N2 or glp-1 nematodes exposed to 0, 100, or 200 J/m2 UVC exhibited marked differences in susceptibility to induction of DNA damage (Figure 2), with starved L1 larvae the most and 1-day-old N2 adults the least susceptible. No differences were observed in terms of damage to the nuclear (DNA polymerase epsilon target) and mitochondrial genome at any life stage. We also compared eggs isolated by bleach-sodium hydroxide treatment but not exposed to UVC, with unexposed eggs isolated by wash-off (eggs already laid), to test whether the bleach-sodium hydroxide treatment had a detectable effect on DNA integrity. No difference was detected (data not shown). | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00022538 | Paper_evidence | WBPaper00029334 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |