WormBase Tree Display for Variation: WBVar00241036
expand all nodes | collapse all nodes | view schema
WBVar00241036 | Evidence | Paper_evidence | WBPaper00001677 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q224 | |||||||
Other_name | CE00237:p.Gly1043Glu | ||||||||
F02A9.6.1:c.3128G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9098521G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | |||||
Flanking_sequences | ctgcattgatgctagtagcacgtgaactcg | aaaacatcaagtggagatggcagagcttct | |||||||
Mapping_target | F02A9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001677 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022516 | ||||||||
WBStrain00022530 | |||||||||
WBStrain00022538 | |||||||||
WBStrain00047329 | |||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001609 | |||||||
Transcript | F02A9.6.1 (12) | ||||||||
Interactor (4) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.163976 | ||||||
Description | Phenotype (20) | ||||||||
Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded robustly to octanol. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000739 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Different life stages of N2 or glp-1 nematodes exposed to 0, 100, or 200 J/m2 UVC exhibited marked differences in susceptibility to induction of DNA damage (Figure 2), with starved L1 larvae the most and 1-day-old N2 adults the least susceptible. No differences were observed in terms of damage to the nuclear (DNA polymerase epsilon target) and mitochondrial genome at any life stage. We also compared eggs isolated by bleach-sodium hydroxide treatment but not exposed to UVC, with unexposed eggs isolated by wash-off (eggs already laid), to test whether the bleach-sodium hydroxide treatment had a detectable effect on DNA integrity. No difference was detected (data not shown). | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00022538 | Paper_evidence | WBPaper00029334 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001938 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No detectable difference in repair was observed between the N2 and glp-1 L1 larvae (Figure 4). Removal of nuclear lesions was apparent in glp-1 adults. In N2 the lesion frequency decreased significantly (Figure 3a) in both the nuclear and mitochondrial genomes at 6 and 24 hours. | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0002430 | Paper_evidence | WBPaper00029334 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Different life stages of N2 or glp-1 nematodes exposed to 0, 100, or 200 J/m2 UVC exhibited marked differences in susceptibility to induction of DNA damage (Figure 2), with starved L1 larvae the most and 1-day-old N2 adults the least susceptible. No differences were observed in terms of damage to the nuclear (DNA polymerase epsilon target) and mitochondrial genome at any life stage. We also compared eggs isolated by bleach-sodium hydroxide treatment but not exposed to UVC, with unexposed eggs isolated by wash-off (eggs already laid), to test whether the bleach-sodium hydroxide treatment had a detectable effect on DNA integrity. No difference was detected (data not shown). | Paper_evidence | WBPaper00029334 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00022538 | Paper_evidence | WBPaper00029334 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |