WormBase Tree Display for Variation: WBVar00239370

WBVar00239370 Evidence: Person_evidence: WBPerson692
  Name: Public_name: pk1426
    Other_name: F10B5.7.1:c.1028+16_3735del
    HGVSg: CHROMOSOME_II:g.8163749_8166763del
  Sequence_details: SMap: S_parent: Sequence: F10B5
    Flanking_sequences: cacagtttgtagtgtgtaagttgcacatat atgatgtcaggtggaaaaccgatgtactac
    Mapping_target: F10B5
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (18)
    Laboratory: NL
    Status: Live
  Affects: Gene: WBGene00004510
    Transcript: F10B5.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F10B5.7.1:c.1028+16_3735del
        cDNA_position: ?-3828
        CDS_position: ?-3735
        Protein_position: ?-1245
        Intron_number: 5-11/16
        Exon_number: 6-12/17
    Interactor (121)
  Isolation: Mutagen: TMP/UV
  Genetics: Interpolated_map_position: II 0.737993
  Description: Phenotype (19)
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Control RNAi (bacteria not expressing any dsRNA). Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
          Temperature: 20 Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Remark: DAF-16::GFP was localized in both the cytoplasm and nuclei of all tissues at all developmental stages, like that in wild-type control animals. Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: daf-16::GFP Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00035228
        Curator_confirmed: WBPerson712
        Remark: PGL-1 staining in the germline resembles wild type and appear associated with nuclei periphery. Paper_evidence: WBPaper00035228
            Curator_confirmed: WBPerson712
      WBPhenotype:0000693 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: rrf-3(pk1426) males produced sperm that were capable of fertilization Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001256 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: Similar patterns in N2 and rrf-3(pk1426) RAD-51 foci counts suggest successful DNA double strand breaks (DSBs) repair Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001759 Paper_evidence: WBPaper00031962
          WBPaper00031961
        Curator_confirmed: WBPerson712
        Remark: These proteins are not required for piRNA expression, as determined by comparable levels of 21U-RNA on Northern blot and or qRT-PCR to that of wild-type. Paper_evidence: WBPaper00031962
            Curator_confirmed: WBPerson712
          21U-RNAs were expressed normally, as determined by Northern blot analysis. Paper_evidence: WBPaper00031961
            Curator_confirmed: WBPerson712
        EQ_annotations: GO_term: GO:0034585 PATO:0000460 Paper_evidence: WBPaper00031962
                Curator_confirmed: WBPerson712
      WBPhenotype:0001779 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: Strains depleted of RRF-3 do not exhibit accumulation of the precursor miRNA species. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
      WBPhenotype:0002146 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: The accumulation of at least eight small RNAs corresponding to germline-expressed genes, including T01A4.3, did not appear to require this gene. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Remark: Presence and morphology of ciliated neurons were assayed by DiO. Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were maintained on control bacteria. Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
  Reference (31)
  Remark: Original flanking sequences were obtained from Plasterk Lab, 11/05. Subsequent re-sequencing (6/09) gives the flanking sequences currently entered above, which are very similar to those quoted in WBPaper00004981.
  Method: Deletion_allele