WormBase Tree Display for Variation: WBVar00239370

WBVar00239370 Evidence: Person_evidence: WBPerson692
  Name: Public_name: pk1426
    Other_name: F10B5.7.1:c.1028+16_3735del
    HGVSg: CHROMOSOME_II:g.8163749_8166763del
  Sequence_details: SMap: S_parent: Sequence: F10B5
    Flanking_sequences: cacagtttgtagtgtgtaagttgcacatat atgatgtcaggtggaaaaccgatgtactac
    Mapping_target: F10B5
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (18)
    Laboratory: NL
    Status: Live
  Affects: Gene: WBGene00004510
    Transcript: F10B5.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F10B5.7.1:c.1028+16_3735del
        cDNA_position: ?-3828
        CDS_position: ?-3735
        Protein_position: ?-1245
        Intron_number: 5-11/16
        Exon_number: 6-12/17
    Interactor (121)
  Isolation: Mutagen: TMP/UV
  Genetics: Interpolated_map_position: II 0.737993
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00032115
          WBPaper00035246
        Curator_confirmed: WBPerson712
          WBPerson2021
        Remark: Homozygotes exhibit low levels of embryonic lethality (11.4% 6.3%, mean SD, n = 272). Paper_evidence: WBPaper00032115
            Curator_confirmed: WBPerson712
          rrf-3(pk1426) self-fertilizing hermaphrodites produced very few fertilized embryos at 25C, with 90% of these nonviable Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00032115
                Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000113 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: rrf-3(pk1426) affects C44B11.6 and K02E2.6 siRNA levels Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000136 Paper_evidence: WBPaper00035324
        Curator_confirmed: WBPerson2021
        Remark: Predicted targets of 26G RNAs are significantly upregulated in the rrf-3 mutant Paper_evidence: WBPaper00035324
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00035324
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000154 Paper_evidence: WBPaper00035199
        Curator_confirmed: WBPerson712
      WBPhenotype:0000290 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: At the expected time of spermatogenesis completion, rrf-3 mutants had a 5-fold reduction in compact, sperm-like nuclei relative to N2 Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000356 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: The production of compact sperm-like nuclei was delayed Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000388 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: Bright wreaths of microtubules surrounding the nuclei of both hermaphrodite and male-derived sperm were clearly visible in 83% of rrf-3 mutant sperm at 23C Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Paper_evidence: WBPaper00038150
        Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00038150
              Curator_confirmed: WBPerson712
      WBPhenotype:0000759 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: Supernumerary microtubule asters associated with the sperm pronucleus or tripolar spindles in rrf-3 mutant one-cell embryos Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000981 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: DAPI-staining after the primary spermatocyte stage revealed nuclear abnormalities such as small or bridged structures. DIC and Hoechst staining revealed both unusual cell morphology and the presence of multiple nuclear structures within individual mutant spermatocytes. No overt defects in meiotic prophase or transitioning between prophase and the first meiotic division Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000983 Paper_evidence: WBPaper00044616
        Curator_confirmed: WBPerson602
        Remark: fer-15(b26) fails to complement the Fer and Eri phenotypes of rrf-3(pk1426). Paper_evidence: WBPaper00044616
            Curator_confirmed: WBPerson602
      WBPhenotype:0000987 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: Embryos sired by pk1426 homozygous males were nonviable. rrf-3 has a paternal effect on embryogenesis Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Paternal: Paper_evidence: WBPaper00035246
          Curator_confirmed: WBPerson2021
      WBPhenotype:0001258 Paper_evidence: WBPaper00027135
          WBPaper00035199
          WBPaper00038150
          WBPaper00027057
          WBPaper00026769
          WBPaper00044616
        Person_evidence: WBPerson692
        Curator_confirmed: WBPerson557
          WBPerson2021
          WBPerson712
          WBPerson602
        Remark: Tissue and RNA-specific enhancement. Exhibits an Eri phenotype that has an upper bound of 95% confidence interval at least 100% penetrant with a ~10% standard deviation in the gonad, intestine, muscle, neuron (hbl-1 and hmr-1), and ubiquitous. Paper_evidence: WBPaper00038150
            Curator_confirmed: WBPerson712
          in wild-type animals, RNAi targeting unc-73 results in a low-penetrance-uncoordinated (Unc) phenotype, such that only about 4% of the F1 progeny of animals exposed to unc-73(RNAi) exhibit the characteristic deformed, poorly motile phenotype. In contrast, these mutants exhibit Unc phenotypes when exposed to unc-73(RNAi). Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
          fer-15(b26) fails to complement the Fer and Eri phenotypes of rrf-3(pk1426). Paper_evidence: WBPaper00044616
            Curator_confirmed: WBPerson602
        Phenotype_assay: Temperature: 25 Paper_evidence: WBPaper00026769
              Curator_confirmed: WBPerson557
      WBPhenotype:0001360 Paper_evidence: WBPaper00035324
        Curator_confirmed: WBPerson2021
        Remark: Mutants are temperature-sensitive (ts) sterile due to defective spermatogenesis Paper_evidence: WBPaper00035324
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00035324
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001384 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: rrf-3(pk1426) self-fertilizing hermaphrodites produced very few fertilized embryos at 25C Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001664 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: rrf-3(pk1426) animals exhibit an X chromosome missegregation phenotype Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035246
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001776 Paper_evidence: WBPaper00035324
        Curator_confirmed: WBPerson2021
        Remark: Both classes of 26G RNAs are abolished in rrf-3(pk1426) Paper_evidence: WBPaper00035324
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00035324
              Curator_confirmed: WBPerson2021
      WBPhenotype:0002147 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: A 5-fold upregulation of K02E2.6 mRNA levels was observed. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
      WBPhenotype:0002150 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: In eri-1 and rrf-3 mutants, the RNAi response to foreign dsRNA is upregulated as are the levels of corresponding exo-siRNAs. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Control RNAi (bacteria not expressing any dsRNA). Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
          Temperature: 20 Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Remark: DAF-16::GFP was localized in both the cytoplasm and nuclei of all tissues at all developmental stages, like that in wild-type control animals. Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: daf-16::GFP Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00035228
        Curator_confirmed: WBPerson712
        Remark: PGL-1 staining in the germline resembles wild type and appear associated with nuclei periphery. Paper_evidence: WBPaper00035228
            Curator_confirmed: WBPerson712
      WBPhenotype:0000693 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: rrf-3(pk1426) males produced sperm that were capable of fertilization Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001256 Paper_evidence: WBPaper00035246
        Curator_confirmed: WBPerson2021
        Remark: Similar patterns in N2 and rrf-3(pk1426) RAD-51 foci counts suggest successful DNA double strand breaks (DSBs) repair Paper_evidence: WBPaper00035246
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001759 Paper_evidence: WBPaper00031962
          WBPaper00031961
        Curator_confirmed: WBPerson712
        Remark: These proteins are not required for piRNA expression, as determined by comparable levels of 21U-RNA on Northern blot and or qRT-PCR to that of wild-type. Paper_evidence: WBPaper00031962
            Curator_confirmed: WBPerson712
          21U-RNAs were expressed normally, as determined by Northern blot analysis. Paper_evidence: WBPaper00031961
            Curator_confirmed: WBPerson712
        EQ_annotations: GO_term: GO:0034585 PATO:0000460 Paper_evidence: WBPaper00031962
                Curator_confirmed: WBPerson712
      WBPhenotype:0001779 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: Strains depleted of RRF-3 do not exhibit accumulation of the precursor miRNA species. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
      WBPhenotype:0002146 Paper_evidence: WBPaper00027057
        Curator_confirmed: WBPerson712
        Remark: The accumulation of at least eight small RNAs corresponding to germline-expressed genes, including T01A4.3, did not appear to require this gene. Paper_evidence: WBPaper00027057
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Paper_evidence: WBPaper00032237
        Curator_confirmed: WBPerson712
        Remark: Presence and morphology of ciliated neurons were assayed by DiO. Paper_evidence: WBPaper00032237
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were maintained on control bacteria. Paper_evidence: WBPaper00032237
              Curator_confirmed: WBPerson712
  Reference (31)
  Remark: Original flanking sequences were obtained from Plasterk Lab, 11/05. Subsequent re-sequencing (6/09) gives the flanking sequences currently entered above, which are very similar to those quoted in WBPaper00004981.
  Method: Deletion_allele