WormBase Tree Display for Variation: WBVar00239302
expand all nodes | collapse all nodes | view schema
| WBVar00239302 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | pk381 | |||||||
| Other_name | pk381df | ||||||||
| HGVSg | CHROMOSOME_IV:g.401309_402794del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T07A9 | |||||
| Flanking_sequences | tctcttgaggatcggttgggatggagatgc | ttgcaatttacctgtagacttttagattag | |||||||
| Mapping_target | T07A9 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00028935 | ||||||||
| Laboratory | NL | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001666 | |||||||
| Transcript | T07A9.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2-4/8 | ||||||||
| Exon_number | 1-4/9 | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | IV | -26.2038 | ||||||
| Mapping_data | In_multi_point | 4370 | |||||||
| Description | Phenotype (15) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | ||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Remark | No defects when tested for response to glucose, CuSo4, 4M fructose, SDS and various volatile chemicals. | Paper_evidence | WBPaper00003465 | ||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Affected_by | Molecule | WBMol:00005569 | Paper_evidence | WBPaper00003465 | |||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00003937 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00002899 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00003977 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Reference | WBPaper00043908 | ||||||||
| WBPaper00031936 | |||||||||
| WBPaper00003465 | |||||||||
| Method | Deletion_allele |
