WormBase Tree Display for Variation: WBVar00239242

WBVar00239242 Name: Public_name: pk204
    Other_name: ZK1098.8.1:c.2435G>A
      CE00370:p.Trp812Ter
    HGVSg: CHROMOSOME_III:g.9539605C>T
  Sequence_details: SMap: S_parent: Sequence: ZK1098
    Flanking_sequences: ttgatatgaagcatacgattc accattctataagtaaaaataaattt
    Mapping_target: ZK1098
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
    Transposon_insertion: Tc1
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00028942
      WBStrain00034635
    Laboratory: NL
    Author: Korswagen RC
      Smits M
      Plasterk RHA
    Status: Live
  Affects: Gene: WBGene00003504
    Transcript: ZK1098.8.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK1098.8.1:c.2435G>A
        HGVSp: CE00370:p.Trp812Ter
        cDNA_position: 2460
        CDS_position: 2435
        Protein_position: 812
        Exon_number: 8/10
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: III 0.579536
    Mapping_data: In_multi_point: 4504
  Description: Phenotype (13)
    Phenotype_not_observed: WBPhenotype:0001759 Paper_evidence: WBPaper00031962
          WBPaper00031961
        Curator_confirmed: WBPerson712
        Remark: Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. Paper_evidence: WBPaper00031962
            Curator_confirmed: WBPerson712
          21U-RNAs were expressed normally, as determined by Northern blot analysis. Paper_evidence: WBPaper00031961
            Curator_confirmed: WBPerson712
        EQ_annotations: GO_term: GO:0034585 PATO:0000460 Paper_evidence: WBPaper00031962
                Curator_confirmed: WBPerson712
  Reference (15)
  Remark: Found by PCR; needs to be confirmed.
  Method: Substitution_allele